1BP_FLANKS(1) User Contributed Perl Documentation BP_FLANKS(1)
2
6 flanks - finding flanking sequences for a variant in a sequence
7 position
8
10 flanks --position POS [-p POS ...] [--flanklen INT]
11 accession | filename
12
14 This script allows you to extract a subsequence around a region of
15 interest from an existing sequence. The output if fasta formatted
16 sequence entry where the header line contains additional information
17 about the location.
18
20 The script takes one unnamed argument which be either a file name in
21 the local file system or a nucleotide sequence accession number.
22 -p Position uses simple nucleotide sequence feature table
24 --position notation to define the region of interest, typically a
25 SNP or microsatellite repeat around which the flanks are
26 defined.
27 There can be more than one position option or you can
29 give a comma separated list to one position option.
30 The format of a position is:
32 [id:] int | range | in-between [-]
34 The optional id is the name you want to call the new
36 sequence. If it not given in joins running number to the
37 entry name with an underscore.
38 The position is either a point (e.g. 234), a range (e.g
40 250..300) or insertion point between nucleotides
41 (e.g. 234^235)
42 If the position is not completely within the source
44 sequence the output sequence will be truncated and it
45 will print a warning.
46 The optional hyphen [-] at the end of the position
48 indicates that that you want the retrieved sequence to be
49 in the opposite strand.
50 -f Defaults to 100. This is the length of the nucleotides
53 --flanklen sequence retrieved on both sides of the given position.
54 If the source file does not contain
56
58 The output is a fasta formatted entry where the description file
59 contains tag=value pairs for information about where in the original
60 sequence the subsequence was taken.
61 The ID of the fasta entry is the name given at the command line joined
63 by hyphen to the filename or accesion of the source sequence. If no id
64 is given a series of consequtive integers is used.
65 The tag=value pairs are:
67 oripos=int
69 position in the source file
70 strand=1|-1
72 strand of the sequence compared to the source sequence
73 allelepos=int
75 position of the region of interest in the current entry. The tag is
76 the same as used by dbSNP@NCBI
77 The sequence highlights the allele variant position by showing it in
79 upper case and rest of the sequence in lower case characters.
80
82 % flanks ~/seq/ar.embl
83 >1_/HOME/HEIKKI/SEQ/AR.EMBL oripos=100 strand=1 allelepos=100
85 taataactcagttcttatttgcacctacttcagtggacactgaatttggaaggtggagga
86 ttttgtttttttcttttaagatctgggcatcttttgaatCtacccttcaagtattaagag
87 acagactgtgagcctagcagggcagatcttgtccaccgtgtgtcttcttctgcacgagac
88 tttgaggctgtcagagcgct
89
91 The input files are assumed to be in EMBL format and the sequences are
92 retrieved only from the EMB database. Make this more generic and use
93 the registry.
94 head1 FEEDBACK
96 Mailing Lists
98 User feedback is an integral part of the evolution of this and other
99 Bioperl modules. Send your comments and suggestions preferably to the
100 Bioperl mailing lists Your participation is much appreciated.
101 bioperl-l@bioperl.org - General discussion
103 http://bioperl.org/wiki/Mailing_lists - About the mailing lists
104 Reporting Bugs
106 Report bugs to the Bioperl bug tracking system to help us keep track
107 the bugs and their resolution. Bug reports can be submitted via the
108 web:
109 http://bugzilla.open-bio.org/
111
113 Email: <heikki-at-bioperl-dot-org>
114perl v5.12.0 2010-04-29 BP_FLANKS(1)