1MCE::Relay(3) User Contributed Perl Documentation MCE::Relay(3)
2
6 MCE::Relay - Extends Many-Core Engine with relay capabilities
7
9 This document describes MCE::Relay version 1.837
10
12 use MCE::Flow;
13 my $file = shift || \*STDIN;
15 ## Line Count #######################################
17 mce_flow_f {
19 max_workers => 4,
20 use_slurpio => 1,
21 init_relay => 0,
22 },
23 sub {
24 my ($mce, $slurp_ref, $chunk_id) = @_;
25 my $line_count = ($$slurp_ref =~ tr/\n//);
26 ## Receive and pass on updated information.
28 my $lines_read = MCE::relay { $_ += $line_count };
29 }, $file;
31 my $total_lines = MCE->relay_final;
33 print {*STDERR} "$total_lines\n";
35 ## Orderly Action ###################################
37 $| = 1; # Important, must flush output immediately.
39 mce_flow_f {
41 max_workers => 2,
42 use_slurpio => 1,
43 init_relay => 0,
44 },
45 sub {
46 my ($mce, $slurp_ref, $chunk_id) = @_;
47 ## The relay value is relayed and remains 0.
49 ## Writes to STDOUT orderly.
50 MCE->relay_lock;
52 print $$slurp_ref;
53 MCE->relay_unlock;
54 }, $file;
56
58 This module enables workers to receive and pass on information orderly
59 with zero involvement by the manager process while running. The module
60 is loaded automatically when MCE option "init_relay" is specified.
61 All workers (belonging to task_id 0) must participate when relaying
63 data.
64 Relaying is not meant for passing big data. The last worker will stall
66 if exceeding the buffer size for the socket. Not exceeding 16 KiB - 7
67 is safe across all platforms.
68
70 MCE->relay ( sub { code } )
71 MCE::relay { code }
72 Relay is enabled by specifying the init_relay option which takes a
73 hash or array reference, or a scalar value. Relaying is orderly and
74 driven by chunk_id when processing data, otherwise task_wid.
75 Omitting the code block (e.g. MCE::relay) relays forward.
76 Below, relaying multiple values via a HASH reference.
78 use MCE::Flow max_workers => 4;
80 mce_flow {
82 init_relay => { p => 0, e => 0 },
83 },
84 sub {
85 my $wid = MCE->wid;
86 ## do work
88 my $pass = $wid % 3;
89 my $errs = $wid % 2;
90 ## relay
92 my %last_rpt = MCE::relay { $_->{p} += $pass; $_->{e} += $errs };
93 MCE->print("$wid: passed $pass, errors $errs\n");
95 return;
97 };
98 my %results = MCE->relay_final;
100 print " passed $results{p}, errors $results{e} final\n\n";
102 -- Output
104 1: passed 1, errors 1
106 2: passed 2, errors 0
107 3: passed 0, errors 1
108 4: passed 1, errors 0
109 passed 4, errors 2 final
110 Or multiple values via an ARRAY reference.
112 use MCE::Flow max_workers => 4;
114 mce_flow {
116 init_relay => [ 0, 0 ],
117 },
118 sub {
119 my $wid = MCE->wid;
120 ## do work
122 my $pass = $wid % 3;
123 my $errs = $wid % 2;
124 ## relay
126 my @last_rpt = MCE::relay { $_->[0] += $pass; $_->[1] += $errs };
127 MCE->print("$wid: passed $pass, errors $errs\n");
129 return;
131 };
132 my ($pass, $errs) = MCE->relay_final;
134 print " passed $pass, errors $errs final\n\n";
136 -- Output
138 1: passed 1, errors 1
140 2: passed 2, errors 0
141 3: passed 0, errors 1
142 4: passed 1, errors 0
143 passed 4, errors 2 final
144 Or simply a scalar value.
146 use MCE::Flow max_workers => 4;
148 mce_flow {
150 init_relay => 0,
151 },
152 sub {
153 my $wid = MCE->wid;
154 ## do work
156 my $bytes_read = 1000 + ((MCE->wid % 3) * 3);
157 ## relay
159 my $last_offset = MCE::relay { $_ += $bytes_read };
160 ## output
162 MCE->print("$wid: $bytes_read\n");
163 return;
165 };
166 my $total = MCE->relay_final;
168 print " $total size\n\n";
170 -- Output
172 1: 1003
174 2: 1006
175 3: 1000
176 4: 1003
177 4012 size
178 MCE->relay_final ( void )
180 Call this method to obtain the final relay value(s) after running.
181 See included example findnull.pl for another use case.
182 use MCE max_workers => 4;
184 my $mce = MCE->new(
186 init_relay => [ 0, 100 ], ## initial values (two counters)
187 user_func => sub {
189 my ($mce) = @_;
190 ## do work
192 my ($acc1, $acc2) = (10, 20);
193 ## relay to next worker
195 MCE::relay { $_->[0] += $acc1; $_->[1] += $acc2 };
196 return;
198 }
199 )->run;
200 my ($cnt1, $cnt2) = $mce->relay_final;
202 print "$cnt1 : $cnt2\n";
204 -- Output
206 40 : 180
208 MCE->relay_recv ( void )
210 Call this method to obtain the next relay value before relaying.
211 This allows serial-code to be processed orderly between workers. The
212 following is a parallel demonstration for the fasta-benchmark on the
213 web.
214 # perl fasta.pl 25000000
216 # The Computer Language Benchmarks game
218 # http://benchmarksgame.alioth.debian.org/
219 #
220 # contributed by Barry Walsh
221 # port of fasta.rb #6
222 #
223 # MCE::Flow version by Mario Roy
224 # requires MCE 1.807+
225 # requires MCE::Shared 1.806+
226 use strict;
228 use warnings;
229 use feature 'say';
230 use MCE::Flow;
232 use MCE::Shared;
233 use MCE::Candy;
234 use constant IM => 139968;
236 use constant IA => 3877;
237 use constant IC => 29573;
238 my $LAST = MCE::Shared->scalar( 42 );
240 my $alu =
242 'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
243 'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
244 'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
245 'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
246 'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
247 'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
248 'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';
249 my $iub = [
251 [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ],
252 [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ],
253 [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ],
254 [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ],
255 [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ]
256 ];
257 my $homosapiens = [
259 [ 'a', 0.3029549426680 ],
260 [ 'c', 0.1979883004921 ],
261 [ 'g', 0.1975473066391 ],
262 [ 't', 0.3015094502008 ]
263 ];
264 sub make_repeat_fasta {
266 my ( $src, $n ) = @_;
267 my $width = qr/(.{1,60})/;
268 my $l = length $src;
269 my $s = $src x ( ($n / $l) + 1 );
270 substr( $s, $n, $l ) = '';
271 while ( $s =~ m/$width/g ) { say $1 }
273 }
274 sub make_random_fasta {
276 my ( $table, $n ) = @_;
277 my $rand = undef;
278 my $width = 60;
279 my $prob = 0.0;
280 my $output = '';
281 my ( $c1, $c2, $last );
282 $_->[1] = ( $prob += $_->[1] ) for @$table;
284 $c1 = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
286 $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$table;
287 my $seq = MCE::Shared->sequence(
289 { chunk_size => 2000, bounds_only => 1 },
290 1, $n / $width
291 );
292 my $code1 = q{
294 while ( 1 ) {
295 # --------------------------------------------
296 # Process code orderly between workers.
297 # --------------------------------------------
298 my $chunk_id = MCE->relay_recv;
300 my ( $begin, $end ) = $seq->next;
301 MCE->relay, last if ( !defined $begin );
303 my $last = $LAST->get;
305 my $temp = $last;
306 # Pre-compute $LAST value for the next worker
308 for ( 1 .. ( $end - $begin + 1 ) * $width ) {
309 $temp = ( $temp * IA + IC ) % IM;
310 }
311 $LAST->set( $temp );
313 # Increment chunk_id value
315 MCE->relay( sub { $_ += 1 } );
316 # --------------------------------------------
318 # Also run code in parallel between workers.
319 # --------------------------------------------
320 for ( $begin .. $end ) {
322 for ( 1 .. $width ) { !C! }
323 $output .= "\n";
324 }
325 # --------------------------------------------
327 # Display orderly.
328 # --------------------------------------------
329 MCE->gather( $chunk_id, $output );
331 $output = '';
333 }
334 };
335 $code1 =~ s/!C!/$c1/g;
337 MCE::Flow->init(
339 max_workers => 4, ## MCE::Util->get_ncpu || 4,
340 gather => MCE::Candy::out_iter_fh( \*STDOUT ),
341 init_relay => 1,
342 use_threads => 0,
343 );
344 MCE::Flow->run( sub { eval $code1 } );
346 MCE::Flow->finish;
347 $last = $LAST->get;
349 $c2 = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
351 $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table;
352 my $code2 = q{
354 if ( $n % $width != 0 ) {
355 for ( 1 .. $n % $width ) { !C! }
356 print "\n";
357 }
358 };
359 $code2 =~ s/!C!/$c2/g;
361 eval $code2;
362 $LAST->set( $last );
364 }
365 my $n = $ARGV[0] || 27;
367 say ">ONE Homo sapiens alu";
369 make_repeat_fasta( $alu, $n * 2 );
370 say ">TWO IUB ambiguity codes";
372 make_random_fasta( $iub, $n * 3 );
373 say ">THREE Homo sapiens frequency";
375 make_random_fasta( $homosapiens, $n * 5 );
376 MCE->relay_lock ( void )
378 MCE->relay_unlock ( void )
379 The "relay_lock" and "relay_unlock" methods, added to MCE 1.807, are
380 aliases for "relay_recv" and "relay" respectively. They allow one to
381 perform an exclusive action prior to actual relaying of data.
382 Below, "user_func" is taken from the "cat.pl" MCE example. Relaying
384 is driven by "chunk_id" or "task_wid" when not processing input,
385 thus occurs orderly.
386 user_func => sub {
388 my ($mce, $chunk_ref, $chunk_id) = @_;
389 if ($n_flag) {
391 ## Relays the total lines read.
392 my $output = ''; my $line_count = ($$chunk_ref =~ tr/\n//);
394 my $lines_read = MCE::relay { $_ += $line_count };
395 open my $fh, '<', $chunk_ref;
397 $output .= sprintf "%6d\t%s", ++$lines_read, $_ while (<$fh>);
398 close $fh;
399 $output .= ":$chunk_id";
401 MCE->do('display_chunk', $output);
402 }
403 else {
404 ## The following is another way to have ordered output. Workers
405 ## write directly to STDOUT exclusively without any involvement
406 ## from the manager process. The statement(s) between relay_lock
407 ## and relay_unlock run serially and most important orderly.
408 MCE->relay_lock; # alias for MCE->relay_recv
410 print $$chunk_ref; # ensure $| = 1 in script
412 MCE->relay_unlock; # alias for MCE->relay
414 }
415 return;
417 }
418 The following is a variant of the fasta-benchmark demonstration
420 shown above. Here, workers write exclusively and orderly to
421 "STDOUT".
422 # perl fasta.pl 25000000
424 # The Computer Language Benchmarks game
426 # http://benchmarksgame.alioth.debian.org/
427 #
428 # contributed by Barry Walsh
429 # port of fasta.rb #6
430 #
431 # MCE::Flow version by Mario Roy
432 # requires MCE 1.807+
433 # requires MCE::Shared 1.806+
434 use strict;
436 use warnings;
437 use feature 'say';
438 use MCE::Flow;
440 use MCE::Shared;
441 use constant IM => 139968;
443 use constant IA => 3877;
444 use constant IC => 29573;
445 my $LAST = MCE::Shared->scalar( 42 );
447 my $alu =
449 'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
450 'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
451 'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
452 'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
453 'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
454 'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
455 'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';
456 my $iub = [
458 [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ],
459 [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ],
460 [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ],
461 [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ],
462 [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ]
463 ];
464 my $homosapiens = [
466 [ 'a', 0.3029549426680 ],
467 [ 'c', 0.1979883004921 ],
468 [ 'g', 0.1975473066391 ],
469 [ 't', 0.3015094502008 ]
470 ];
471 sub make_repeat_fasta {
473 my ( $src, $n ) = @_;
474 my $width = qr/(.{1,60})/;
475 my $l = length $src;
476 my $s = $src x ( ($n / $l) + 1 );
477 substr( $s, $n, $l ) = '';
478 while ( $s =~ m/$width/g ) { say $1 }
480 }
481 sub make_random_fasta {
483 my ( $table, $n ) = @_;
484 my $rand = undef;
485 my $width = 60;
486 my $prob = 0.0;
487 my $output = '';
488 my ( $c1, $c2, $last );
489 $_->[1] = ( $prob += $_->[1] ) for @$table;
491 $c1 = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
493 $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$table;
494 my $seq = MCE::Shared->sequence(
496 { chunk_size => 2000, bounds_only => 1 },
497 1, $n / $width
498 );
499 my $code1 = q{
501 $| = 1; # Important, must flush output immediately.
502 while ( 1 ) {
504 # --------------------------------------------
505 # Process code orderly between workers.
506 # --------------------------------------------
507 MCE->relay_lock;
509 my ( $begin, $end ) = $seq->next;
511 print( $output ), $output = '' if ( length $output );
512 MCE->relay_unlock, last if ( !defined $begin );
514 my $last = $LAST->get;
516 my $temp = $last;
517 # Pre-compute $LAST value for the next worker
519 for ( 1 .. ( $end - $begin + 1 ) * $width ) {
520 $temp = ( $temp * IA + IC ) % IM;
521 }
522 $LAST->set( $temp );
524 MCE->relay_unlock;
526 # --------------------------------------------
528 # Also run code in parallel.
529 # --------------------------------------------
530 for ( $begin .. $end ) {
532 for ( 1 .. $width ) { !C! }
533 $output .= "\n";
534 }
535 }
536 };
537 $code1 =~ s/!C!/$c1/g;
539 MCE::Flow->init(
541 max_workers => 4, ## MCE::Util->get_ncpu || 4,
542 init_relay => 0,
543 use_threads => 0,
544 );
545 MCE::Flow->run( sub { eval $code1 } );
547 MCE::Flow->finish;
548 $last = $LAST->get;
550 $c2 = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
552 $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table;
553 my $code2 = q{
555 if ( $n % $width != 0 ) {
556 for ( 1 .. $n % $width ) { !C! }
557 print "\n";
558 }
559 };
560 $code2 =~ s/!C!/$c2/g;
562 eval $code2;
563 $LAST->set( $last );
565 }
566 my $n = $ARGV[0] || 27;
568 say ">ONE Homo sapiens alu";
570 make_repeat_fasta( $alu, $n * 2 );
571 say ">TWO IUB ambiguity codes";
573 make_random_fasta( $iub, $n * 3 );
574 say ">THREE Homo sapiens frequency";
576 make_random_fasta( $homosapiens, $n * 5 );
577
579 I received a request from John Martel to process a large flat file and
580 expand each record to many records based on splitting out items in
581 field 4 delimited by semicolons. Each row in the output is given a
582 unique ID starting with one while preserving output order.
583 Input File, possibly larger than 500 GiB in size
585 foo|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
586 bar|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
587 baz|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
588 ...
589 Output File
591 000000000000001|item1|foo|field2|field3|field5|field6|field7
592 000000000000002|item2|foo|field2|field3|field5|field6|field7
593 000000000000003|item3|foo|field2|field3|field5|field6|field7
594 000000000000004|item4|foo|field2|field3|field5|field6|field7
595 000000000000005|itemN|foo|field2|field3|field5|field6|field7
596 000000000000006|item1|bar|field2|field3|field5|field6|field7
597 000000000000007|item2|bar|field2|field3|field5|field6|field7
598 000000000000008|item3|bar|field2|field3|field5|field6|field7
599 000000000000009|item4|bar|field2|field3|field5|field6|field7
600 000000000000010|itemN|bar|field2|field3|field5|field6|field7
601 000000000000011|item1|baz|field2|field3|field5|field6|field7
602 000000000000012|item2|baz|field2|field3|field5|field6|field7
603 000000000000013|item3|baz|field2|field3|field5|field6|field7
604 000000000000014|item4|baz|field2|field3|field5|field6|field7
605 000000000000015|itemN|baz|field2|field3|field5|field6|field7
606 ...
607 Example One
609 This example configures a custom function for preserving output
610 order. Unfortunately, the sprintf function alone involves extra CPU
611 time causing the manager process to fall behind. Thus, workers may
612 idle while waiting for the manager process to respond to the gather
613 request.
614 use strict;
616 use warnings;
617 use MCE::Loop;
619 my $infile = shift or die "Usage: $0 infile\n";
621 my $newfile = 'output.dat';
622 open my $fh_out, '>', $newfile or die "open error $newfile: $!\n";
624 sub preserve_order {
626 my ($fh) = @_;
627 my ($order_id, $start_idx, $idx, %tmp) = (1, 1);
628 return sub {
630 my ($chunk_id, $aref) = @_;
631 $tmp{ $chunk_id } = $aref;
632 while ( my $aref = delete $tmp{ $order_id } ) {
634 foreach my $line ( @{ $aref } ) {
635 $idx = sprintf "%015d", $start_idx++;
636 print $fh $idx, $line;
637 }
638 $order_id++;
639 }
640 }
641 }
642 MCE::Loop::init {
644 chunk_size => 'auto', max_workers => 3,
645 gather => preserve_order($fh_out)
646 };
647 mce_loop_f {
649 my ($mce, $chunk_ref, $chunk_id) = @_;
650 my @buf;
651 foreach my $line (@{ $chunk_ref }) {
653 $line =~ s/\r//g; chomp $line;
654 my ($f1,$f2,$f3,$items,$f5,$f6,$f7) = split /\|/, $line;
656 my @items_array = split /;/, $items;
657 foreach my $item (@items_array) {
659 push @buf, "|$item|$f1|$f2|$f3|$f5|$f6|$f7\n";
660 }
661 }
662 MCE->gather($chunk_id, \@buf);
664 } $infile;
666 MCE::Loop::finish();
668 close $fh_out;
669 Example Two
671 In this example, workers obtain the current ID value and
672 increment/relay for the next worker, ordered by chunk ID behind the
673 scene. Workers call sprintf in parallel, allowing the manager
674 process (out_iter_fh) to accommodate up to 32 workers and not fall
675 behind.
676 Relay accounts for the worker handling the next chunk_id value.
678 Therefore, do not call relay more than once per chunk. Doing so will
679 cause IPC to stall.
680 use strict;
682 use warnings;
683 use MCE::Loop;
685 use MCE::Candy;
686 my $infile = shift or die "Usage: $0 infile\n";
688 my $newfile = 'output.dat';
689 open my $fh_out, '>', $newfile or die "open error $newfile: $!\n";
691 MCE::Loop::init {
693 chunk_size => 'auto', max_workers => 8,
694 gather => MCE::Candy::out_iter_fh($fh_out),
695 init_relay => 1
696 };
697 mce_loop_f {
699 my ($mce, $chunk_ref, $chunk_id) = @_;
700 my @lines;
701 foreach my $line (@{ $chunk_ref }) {
703 $line =~ s/\r//g; chomp $line;
704 my ($f1,$f2,$f3,$items,$f5,$f6,$f7) = split /\|/, $line;
706 my @items_array = split /;/, $items;
707 foreach my $item (@items_array) {
709 push @lines, "$item|$f1|$f2|$f3|$f5|$f6|$f7\n";
710 }
711 }
712 my $idx = MCE::relay { $_ += scalar @lines };
714 my $buf = '';
715 foreach my $line ( @lines ) {
717 $buf .= sprintf "%015d|%s", $idx++, $line
718 }
719 MCE->gather($chunk_id, $buf);
721 } $infile;
723 MCE::Loop::finish();
725 close $fh_out;
726
728 MCE, MCE::Core
729
731 Mario E. Roy, <marioeroy AT gmail DOT com>
732perl v5.28.0 2018-08-25 MCE::Relay(3)