1MCE::Relay(3) User Contributed Perl Documentation MCE::Relay(3)
2
6 MCE::Relay - Extends Many-Core Engine with relay capabilities
7
9 This document describes MCE::Relay version 1.874
10
12 use MCE::Flow;
13 my $file = shift || \*STDIN;
15 ## Line Count #######################################
17 mce_flow_f {
19 max_workers => 4,
20 use_slurpio => 1,
21 init_relay => 0,
22 },
23 sub {
24 my ($mce, $slurp_ref, $chunk_id) = @_;
25 my $line_count = ($$slurp_ref =~ tr/\n//);
26 ## Receive and pass on updated information.
28 my $lines_read = MCE::relay { $_ += $line_count };
29 }, $file;
31 my $total_lines = MCE->relay_final;
33 print {*STDERR} "$total_lines\n";
35 ## Orderly Action ###################################
37 $| = 1; # Important, must flush output immediately.
39 mce_flow_f {
41 max_workers => 2,
42 use_slurpio => 1,
43 init_relay => 0,
44 },
45 sub {
46 my ($mce, $slurp_ref, $chunk_id) = @_;
47 ## The relay value is relayed and remains 0.
49 ## Writes to STDOUT orderly.
50 MCE->relay_lock;
52 print $$slurp_ref;
53 MCE->relay_unlock;
54 }, $file;
56
58 This module enables workers to receive and pass on information orderly
59 with zero involvement by the manager process while running. The module
60 is loaded automatically when MCE option "init_relay" is specified.
61 All workers (belonging to task_id 0) must participate when relaying
63 data.
64 Relaying is not meant for passing big data. The last worker will stall
66 if exceeding the buffer size for the socket. Not exceeding 16 KiB - 7
67 is safe across all platforms.
68
70 MCE::relay { code }
71 MCE->relay ( sub { code } )
72 $mce->relay ( sub { code } )
73 Relay is enabled by specifying the init_relay option which takes a hash
75 or array reference, or a scalar value. Relaying is orderly and driven
76 by chunk_id when processing data, otherwise task_wid. Omitting the code
77 block (e.g. MCE::relay) relays forward.
78 Below, relaying multiple values via a HASH reference.
80 use MCE::Flow max_workers => 4;
82 mce_flow {
84 init_relay => { p => 0, e => 0 },
85 },
86 sub {
87 my $wid = MCE->wid;
88 ## do work
90 my $pass = $wid % 3;
91 my $errs = $wid % 2;
92 ## relay
94 my %last_rpt = MCE::relay { $_->{p} += $pass; $_->{e} += $errs };
95 MCE->print("$wid: passed $pass, errors $errs\n");
97 return;
99 };
100 my %results = MCE->relay_final;
102 print " passed $results{p}, errors $results{e} final\n\n";
104 -- Output
106 1: passed 1, errors 1
108 2: passed 2, errors 0
109 3: passed 0, errors 1
110 4: passed 1, errors 0
111 passed 4, errors 2 final
112 Or multiple values via an ARRAY reference.
114 use MCE::Flow max_workers => 4;
116 mce_flow {
118 init_relay => [ 0, 0 ],
119 },
120 sub {
121 my $wid = MCE->wid;
122 ## do work
124 my $pass = $wid % 3;
125 my $errs = $wid % 2;
126 ## relay
128 my @last_rpt = MCE::relay { $_->[0] += $pass; $_->[1] += $errs };
129 MCE->print("$wid: passed $pass, errors $errs\n");
131 return;
133 };
134 my ($pass, $errs) = MCE->relay_final;
136 print " passed $pass, errors $errs final\n\n";
138 -- Output
140 1: passed 1, errors 1
142 2: passed 2, errors 0
143 3: passed 0, errors 1
144 4: passed 1, errors 0
145 passed 4, errors 2 final
146 Or simply a scalar value.
148 use MCE::Flow max_workers => 4;
150 mce_flow {
152 init_relay => 0,
153 },
154 sub {
155 my $wid = MCE->wid;
156 ## do work
158 my $bytes_read = 1000 + ((MCE->wid % 3) * 3);
159 ## relay
161 my $last_offset = MCE::relay { $_ += $bytes_read };
162 ## output
164 MCE->print("$wid: $bytes_read\n");
165 return;
167 };
168 my $total = MCE->relay_final;
170 print " $total size\n\n";
172 -- Output
174 1: 1003
176 2: 1006
177 3: 1000
178 4: 1003
179 4012 size
180 MCE->relay_final ( void )
182 $mce->relay_final ( void )
183 Call this method to obtain the final relay value(s) after running. See
185 included example findnull.pl for another use case.
186 use MCE max_workers => 4;
188 my $mce = MCE->new(
190 init_relay => [ 0, 100 ], ## initial values (two counters)
191 user_func => sub {
193 my ($mce) = @_;
194 ## do work
196 my ($acc1, $acc2) = (10, 20);
197 ## relay to next worker
199 MCE::relay { $_->[0] += $acc1; $_->[1] += $acc2 };
200 return;
202 }
203 )->run;
204 my ($cnt1, $cnt2) = $mce->relay_final;
206 print "$cnt1 : $cnt2\n";
208 -- Output
210 40 : 180
212 MCE->relay_recv ( void )
214 $mce->relay_recv ( void )
215 Call this method to obtain the next relay value before relaying. This
217 allows serial-code to be processed orderly between workers. The
218 following is a parallel demonstration for the fasta-benchmark on the
219 web.
220 # perl fasta.pl 25000000
222 # The Computer Language Benchmarks game
224 # http://benchmarksgame.alioth.debian.org/
225 #
226 # contributed by Barry Walsh
227 # port of fasta.rb #6
228 #
229 # MCE::Flow version by Mario Roy
230 # requires MCE 1.807+
231 # requires MCE::Shared 1.806+
232 use strict;
234 use warnings;
235 use feature 'say';
236 use MCE::Flow;
238 use MCE::Shared;
239 use MCE::Candy;
240 use constant IM => 139968;
242 use constant IA => 3877;
243 use constant IC => 29573;
244 my $LAST = MCE::Shared->scalar( 42 );
246 my $alu =
248 'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
249 'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
250 'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
251 'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
252 'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
253 'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
254 'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';
255 my $iub = [
257 [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ],
258 [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ],
259 [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ],
260 [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ],
261 [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ]
262 ];
263 my $homosapiens = [
265 [ 'a', 0.3029549426680 ],
266 [ 'c', 0.1979883004921 ],
267 [ 'g', 0.1975473066391 ],
268 [ 't', 0.3015094502008 ]
269 ];
270 sub make_repeat_fasta {
272 my ( $src, $n ) = @_;
273 my $width = qr/(.{1,60})/;
274 my $l = length $src;
275 my $s = $src x ( ($n / $l) + 1 );
276 substr( $s, $n, $l ) = '';
277 while ( $s =~ m/$width/g ) { say $1 }
279 }
280 sub make_random_fasta {
282 my ( $table, $n ) = @_;
283 my $rand = undef;
284 my $width = 60;
285 my $prob = 0.0;
286 my $output = '';
287 my ( $c1, $c2, $last );
288 $_->[1] = ( $prob += $_->[1] ) for @$table;
290 $c1 = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
292 $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$table;
293 my $seq = MCE::Shared->sequence(
295 { chunk_size => 2000, bounds_only => 1 },
296 1, $n / $width
297 );
298 my $code1 = q{
300 while ( 1 ) {
301 # --------------------------------------------
302 # Process code orderly between workers.
303 # --------------------------------------------
304 my $chunk_id = MCE->relay_recv;
306 my ( $begin, $end ) = $seq->next;
307 MCE->relay, last if ( !defined $begin );
309 my $last = $LAST->get;
311 my $temp = $last;
312 # Pre-compute $LAST value for the next worker
314 for ( 1 .. ( $end - $begin + 1 ) * $width ) {
315 $temp = ( $temp * IA + IC ) % IM;
316 }
317 $LAST->set( $temp );
319 # Increment chunk_id value
321 MCE->relay( sub { $_ += 1 } );
322 # --------------------------------------------
324 # Also run code in parallel between workers.
325 # --------------------------------------------
326 for ( $begin .. $end ) {
328 for ( 1 .. $width ) { !C! }
329 $output .= "\n";
330 }
331 # --------------------------------------------
333 # Display orderly.
334 # --------------------------------------------
335 MCE->gather( $chunk_id, $output );
337 $output = '';
339 }
340 };
341 $code1 =~ s/!C!/$c1/g;
343 MCE::Flow->init(
345 max_workers => 4, ## MCE::Util->get_ncpu || 4,
346 gather => MCE::Candy::out_iter_fh( \*STDOUT ),
347 init_relay => 1,
348 use_threads => 0,
349 );
350 MCE::Flow->run( sub { eval $code1 } );
352 MCE::Flow->finish;
353 $last = $LAST->get;
355 $c2 = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
357 $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table;
358 my $code2 = q{
360 if ( $n % $width != 0 ) {
361 for ( 1 .. $n % $width ) { !C! }
362 print "\n";
363 }
364 };
365 $code2 =~ s/!C!/$c2/g;
367 eval $code2;
368 $LAST->set( $last );
370 }
371 my $n = $ARGV[0] || 27;
373 say ">ONE Homo sapiens alu";
375 make_repeat_fasta( $alu, $n * 2 );
376 say ">TWO IUB ambiguity codes";
378 make_random_fasta( $iub, $n * 3 );
379 say ">THREE Homo sapiens frequency";
381 make_random_fasta( $homosapiens, $n * 5 );
382 MCE->relay_lock ( void )
384 MCE->relay_unlock ( void )
385 $mce->relay_lock ( void )
386 $mce->relay_unlock ( void )
387 The "relay_lock" and "relay_unlock" methods, added to MCE 1.807, are
389 aliases for "relay_recv" and "relay" respectively. Together, they allow
390 one to perform an exclusive action prior to actual relaying of data.
391 Relaying is driven by "chunk_id" or "task_wid" when not processing
393 input, as seen here.
394 MCE->new(
396 max_workers => 8,
397 init_relay => 0,
398 user_func => sub {
399 MCE->relay_lock;
400 MCE->say("wid: ", MCE->task_wid);
401 MCE->relay_unlock( sub {
402 $_ += 2;
403 });
404 }
405 )->run;
406 MCE->say("sum: ", MCE->relay_final);
408 __END__
410 wid: 1
412 wid: 2
413 wid: 3
414 wid: 4
415 wid: 5
416 wid: 6
417 wid: 7
418 wid: 8
419 sum: 16
420 Described above, "relay" takes a code block and combines "relay_lock"
422 and "relay_unlock" into a single call. To make this more interesting, I
423 define "init_relay" to a hash containing two key-value pairs.
424 MCE->new(
426 max_workers => 8,
427 init_relay => { count => 0, total => 0 },
428 user_func => sub {
429 MCE->relay_lock;
430 MCE->say("wid: ", MCE->task_wid);
431 MCE->relay_unlock( sub {
432 $_->{count} += 1;
433 $_->{total} += 2;
434 });
435 }
436 )->run;
437 my %results = MCE->relay_final;
439 MCE->say("count: ", $results{count});
441 MCE->say("total: ", $results{total});
442 __END__
444 wid: 1
446 wid: 2
447 wid: 3
448 wid: 4
449 wid: 5
450 wid: 6
451 wid: 7
452 wid: 8
453 count: 8
454 total: 16
455 Below, "user_func" is taken from the "cat.pl" MCE example. Incrementing
457 the count is done only when the "-n" switch is passed to the script.
458 Otherwise, output is displaced orderly and not necessary to update the
459 $_ value if exclusive locking is all you need.
460 user_func => sub {
462 my ($mce, $chunk_ref, $chunk_id) = @_;
463 if ($n_flag) {
465 ## Relays the total lines read.
466 my $output = ''; my $line_count = ($$chunk_ref =~ tr/\n//);
468 my $lines_read = MCE::relay { $_ += $line_count };
469 open my $fh, '<', $chunk_ref;
471 $output .= sprintf "%6d\t%s", ++$lines_read, $_ while (<$fh>);
472 close $fh;
473 $output .= ":$chunk_id";
475 MCE->do('display_chunk', $output);
476 }
477 else {
478 ## The following is another way to have ordered output. Workers
479 ## write directly to STDOUT exclusively without any involvement
480 ## from the manager process. The statement(s) between relay_lock
481 ## and relay_unlock run serially and most important orderly.
482 MCE->relay_lock; # alias for MCE->relay_recv
484 print $$chunk_ref; # ensure $| = 1 in script
485 MCE->relay_unlock; # alias for MCE->relay
486 }
487 return;
489 }
490 The following is a variant of the fasta-benchmark demonstration shown
492 above. Here, workers write exclusively and orderly to "STDOUT".
493 # perl fasta.pl 25000000
495 # The Computer Language Benchmarks game
497 # http://benchmarksgame.alioth.debian.org/
498 #
499 # contributed by Barry Walsh
500 # port of fasta.rb #6
501 #
502 # MCE::Flow version by Mario Roy
503 # requires MCE 1.807+
504 # requires MCE::Shared 1.806+
505 use strict;
507 use warnings;
508 use feature 'say';
509 use MCE::Flow;
511 use MCE::Shared;
512 use constant IM => 139968;
514 use constant IA => 3877;
515 use constant IC => 29573;
516 my $LAST = MCE::Shared->scalar( 42 );
518 my $alu =
520 'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
521 'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
522 'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
523 'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
524 'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
525 'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
526 'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';
527 my $iub = [
529 [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ],
530 [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ],
531 [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ],
532 [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ],
533 [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ]
534 ];
535 my $homosapiens = [
537 [ 'a', 0.3029549426680 ],
538 [ 'c', 0.1979883004921 ],
539 [ 'g', 0.1975473066391 ],
540 [ 't', 0.3015094502008 ]
541 ];
542 sub make_repeat_fasta {
544 my ( $src, $n ) = @_;
545 my $width = qr/(.{1,60})/;
546 my $l = length $src;
547 my $s = $src x ( ($n / $l) + 1 );
548 substr( $s, $n, $l ) = '';
549 while ( $s =~ m/$width/g ) { say $1 }
551 }
552 sub make_random_fasta {
554 my ( $table, $n ) = @_;
555 my $rand = undef;
556 my $width = 60;
557 my $prob = 0.0;
558 my $output = '';
559 my ( $c1, $c2, $last );
560 $_->[1] = ( $prob += $_->[1] ) for @$table;
562 $c1 = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
564 $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$table;
565 my $seq = MCE::Shared->sequence(
567 { chunk_size => 2000, bounds_only => 1 },
568 1, $n / $width
569 );
570 my $code1 = q{
572 $| = 1; # Important, must flush output immediately.
573 while ( 1 ) {
575 # --------------------------------------------
576 # Process code orderly between workers.
577 # --------------------------------------------
578 MCE->relay_lock;
580 my ( $begin, $end ) = $seq->next;
582 print( $output ), $output = '' if ( length $output );
583 MCE->relay_unlock, last if ( !defined $begin );
585 my $last = $LAST->get;
587 my $temp = $last;
588 # Pre-compute $LAST value for the next worker
590 for ( 1 .. ( $end - $begin + 1 ) * $width ) {
591 $temp = ( $temp * IA + IC ) % IM;
592 }
593 $LAST->set( $temp );
595 MCE->relay_unlock;
597 # --------------------------------------------
599 # Also run code in parallel.
600 # --------------------------------------------
601 for ( $begin .. $end ) {
603 for ( 1 .. $width ) { !C! }
604 $output .= "\n";
605 }
606 }
607 };
608 $code1 =~ s/!C!/$c1/g;
610 MCE::Flow->init(
612 max_workers => 4, ## MCE::Util->get_ncpu || 4,
613 init_relay => 0,
614 use_threads => 0,
615 );
616 MCE::Flow->run( sub { eval $code1 } );
618 MCE::Flow->finish;
619 $last = $LAST->get;
621 $c2 = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
623 $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table;
624 my $code2 = q{
626 if ( $n % $width != 0 ) {
627 for ( 1 .. $n % $width ) { !C! }
628 print "\n";
629 }
630 };
631 $code2 =~ s/!C!/$c2/g;
633 eval $code2;
634 $LAST->set( $last );
636 }
637 my $n = $ARGV[0] || 27;
639 say ">ONE Homo sapiens alu";
641 make_repeat_fasta( $alu, $n * 2 );
642 say ">TWO IUB ambiguity codes";
644 make_random_fasta( $iub, $n * 3 );
645 say ">THREE Homo sapiens frequency";
647 make_random_fasta( $homosapiens, $n * 5 );
648
650 I received a request from John Martel to process a large flat file and
651 expand each record to many records based on splitting out items in
652 field 4 delimited by semicolons. Each row in the output is given a
653 unique ID starting with one while preserving output order.
654 Input File, possibly larger than 500 GiB in size
656 foo|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
657 bar|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
658 baz|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
659 ...
660 Output File
662 000000000000001|item1|foo|field2|field3|field5|field6|field7
663 000000000000002|item2|foo|field2|field3|field5|field6|field7
664 000000000000003|item3|foo|field2|field3|field5|field6|field7
665 000000000000004|item4|foo|field2|field3|field5|field6|field7
666 000000000000005|itemN|foo|field2|field3|field5|field6|field7
667 000000000000006|item1|bar|field2|field3|field5|field6|field7
668 000000000000007|item2|bar|field2|field3|field5|field6|field7
669 000000000000008|item3|bar|field2|field3|field5|field6|field7
670 000000000000009|item4|bar|field2|field3|field5|field6|field7
671 000000000000010|itemN|bar|field2|field3|field5|field6|field7
672 000000000000011|item1|baz|field2|field3|field5|field6|field7
673 000000000000012|item2|baz|field2|field3|field5|field6|field7
674 000000000000013|item3|baz|field2|field3|field5|field6|field7
675 000000000000014|item4|baz|field2|field3|field5|field6|field7
676 000000000000015|itemN|baz|field2|field3|field5|field6|field7
677 ...
678 Example One
680 This example configures a custom function for preserving output order.
682 Unfortunately, the sprintf function alone involves extra CPU time
683 causing the manager process to fall behind. Thus, workers may idle
684 while waiting for the manager process to respond to the gather request.
685 use strict;
687 use warnings;
688 use MCE::Loop;
690 my $infile = shift or die "Usage: $0 infile\n";
692 my $newfile = 'output.dat';
693 open my $fh_out, '>', $newfile or die "open error $newfile: $!\n";
695 sub preserve_order {
697 my ($fh) = @_;
698 my ($order_id, $start_idx, $idx, %tmp) = (1, 1);
699 return sub {
701 my ($chunk_id, $aref) = @_;
702 $tmp{ $chunk_id } = $aref;
703 while ( my $aref = delete $tmp{ $order_id } ) {
705 foreach my $line ( @{ $aref } ) {
706 $idx = sprintf "%015d", $start_idx++;
707 print $fh $idx, $line;
708 }
709 $order_id++;
710 }
711 }
712 }
713 MCE::Loop->init(
715 chunk_size => 'auto', max_workers => 3,
716 gather => preserve_order($fh_out)
717 );
718 mce_loop_f {
720 my ($mce, $chunk_ref, $chunk_id) = @_;
721 my @buf;
722 foreach my $line (@{ $chunk_ref }) {
724 $line =~ s/\r//g; chomp $line;
725 my ($f1,$f2,$f3,$items,$f5,$f6,$f7) = split /\|/, $line;
727 my @items_array = split /;/, $items;
728 foreach my $item (@items_array) {
730 push @buf, "|$item|$f1|$f2|$f3|$f5|$f6|$f7\n";
731 }
732 }
733 MCE->gather($chunk_id, \@buf);
735 } $infile;
737 MCE::Loop->finish();
739 close $fh_out;
740 Example Two
742 In this example, workers obtain the current ID value and
744 increment/relay for the next worker, ordered by chunk ID behind the
745 scene. Workers call sprintf in parallel, allowing the manager process
746 (out_iter_fh) to accommodate up to 32 workers and not fall behind.
747 Relay accounts for the worker handling the next chunk_id value.
749 Therefore, do not call relay more than once per chunk. Doing so will
750 cause IPC to stall.
751 use strict;
753 use warnings;
754 use MCE::Loop;
756 use MCE::Candy;
757 my $infile = shift or die "Usage: $0 infile\n";
759 my $newfile = 'output.dat';
760 open my $fh_out, '>', $newfile or die "open error $newfile: $!\n";
762 MCE::Loop->init(
764 chunk_size => 'auto', max_workers => 8,
765 gather => MCE::Candy::out_iter_fh($fh_out),
766 init_relay => 1
767 );
768 mce_loop_f {
770 my ($mce, $chunk_ref, $chunk_id) = @_;
771 my @lines;
772 foreach my $line (@{ $chunk_ref }) {
774 $line =~ s/\r//g; chomp $line;
775 my ($f1,$f2,$f3,$items,$f5,$f6,$f7) = split /\|/, $line;
777 my @items_array = split /;/, $items;
778 foreach my $item (@items_array) {
780 push @lines, "$item|$f1|$f2|$f3|$f5|$f6|$f7\n";
781 }
782 }
783 my $idx = MCE::relay { $_ += scalar @lines };
785 my $buf = '';
786 foreach my $line ( @lines ) {
788 $buf .= sprintf "%015d|%s", $idx++, $line
789 }
790 MCE->gather($chunk_id, $buf);
792 } $infile;
794 MCE::Loop->finish();
796 close $fh_out;
797
799 MCE, MCE::Core
800
802 Mario E. Roy, <marioeroy AT gmail DOT com>
803perl v5.34.0 2021-07-22 MCE::Relay(3)