1PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
2
3
4
6 perlretut - Perl regular expressions tutorial
7
9 This page provides a basic tutorial on understanding, creating and
10 using regular expressions in Perl. It serves as a complement to the
11 reference page on regular expressions perlre. Regular expressions are
12 an integral part of the "m//", "s///", "qr//" and "split" operators and
13 so this tutorial also overlaps with "Regexp Quote-Like Operators" in
14 perlop and "split" in perlfunc.
15
16 Perl is widely renowned for excellence in text processing, and regular
17 expressions are one of the big factors behind this fame. Perl regular
18 expressions display an efficiency and flexibility unknown in most other
19 computer languages. Mastering even the basics of regular expressions
20 will allow you to manipulate text with surprising ease.
21
22 What is a regular expression? At its most basic, a regular expression
23 is a template that is used to determine if a string has certain
24 characteristics. The string is most often some text, such as a line,
25 sentence, web page, or even a whole book, but less commonly it could be
26 some binary data as well. Suppose we want to determine if the text in
27 variable, $var contains the sequence of characters "m u s h r o o m"
28 (blanks added for legibility). We can write in Perl
29
30 $var =~ m/mushroom/
31
32 The value of this expression will be TRUE if $var contains that
33 sequence of characters, and FALSE otherwise. The portion enclosed in
34 '/' characters denotes the characteristic we are looking for. We use
35 the term pattern for it. The process of looking to see if the pattern
36 occurs in the string is called matching, and the "=~" operator along
37 with the "m//" tell Perl to try to match the pattern against the
38 string. Note that the pattern is also a string, but a very special
39 kind of one, as we will see. Patterns are in common use these days;
40 examples are the patterns typed into a search engine to find web pages
41 and the patterns used to list files in a directory, e.g., ""ls *.txt""
42 or ""dir *.*"". In Perl, the patterns described by regular expressions
43 are used not only to search strings, but to also extract desired parts
44 of strings, and to do search and replace operations.
45
46 Regular expressions have the undeserved reputation of being abstract
47 and difficult to understand. This really stems simply because the
48 notation used to express them tends to be terse and dense, and not
49 because of inherent complexity. We recommend using the "/x" regular
50 expression modifier (described below) along with plenty of white space
51 to make them less dense, and easier to read. Regular expressions are
52 constructed using simple concepts like conditionals and loops and are
53 no more difficult to understand than the corresponding "if"
54 conditionals and "while" loops in the Perl language itself.
55
56 This tutorial flattens the learning curve by discussing regular
57 expression concepts, along with their notation, one at a time and with
58 many examples. The first part of the tutorial will progress from the
59 simplest word searches to the basic regular expression concepts. If
60 you master the first part, you will have all the tools needed to solve
61 about 98% of your needs. The second part of the tutorial is for those
62 comfortable with the basics and hungry for more power tools. It
63 discusses the more advanced regular expression operators and introduces
64 the latest cutting-edge innovations.
65
66 A note: to save time, "regular expression" is often abbreviated as
67 regexp or regex. Regexp is a more natural abbreviation than regex, but
68 is harder to pronounce. The Perl pod documentation is evenly split on
69 regexp vs regex; in Perl, there is more than one way to abbreviate it.
70 We'll use regexp in this tutorial.
71
72 New in v5.22, "use re 'strict'" applies stricter rules than otherwise
73 when compiling regular expression patterns. It can find things that,
74 while legal, may not be what you intended.
75
77 Simple word matching
78 The simplest regexp is simply a word, or more generally, a string of
79 characters. A regexp consisting of just a word matches any string that
80 contains that word:
81
82 "Hello World" =~ /World/; # matches
83
84 What is this Perl statement all about? "Hello World" is a simple
85 double-quoted string. "World" is the regular expression and the "//"
86 enclosing "/World/" tells Perl to search a string for a match. The
87 operator "=~" associates the string with the regexp match and produces
88 a true value if the regexp matched, or false if the regexp did not
89 match. In our case, "World" matches the second word in "Hello World",
90 so the expression is true. Expressions like this are useful in
91 conditionals:
92
93 if ("Hello World" =~ /World/) {
94 print "It matches\n";
95 }
96 else {
97 print "It doesn't match\n";
98 }
99
100 There are useful variations on this theme. The sense of the match can
101 be reversed by using the "!~" operator:
102
103 if ("Hello World" !~ /World/) {
104 print "It doesn't match\n";
105 }
106 else {
107 print "It matches\n";
108 }
109
110 The literal string in the regexp can be replaced by a variable:
111
112 my $greeting = "World";
113 if ("Hello World" =~ /$greeting/) {
114 print "It matches\n";
115 }
116 else {
117 print "It doesn't match\n";
118 }
119
120 If you're matching against the special default variable $_, the "$_ =~"
121 part can be omitted:
122
123 $_ = "Hello World";
124 if (/World/) {
125 print "It matches\n";
126 }
127 else {
128 print "It doesn't match\n";
129 }
130
131 And finally, the "//" default delimiters for a match can be changed to
132 arbitrary delimiters by putting an 'm' out front:
133
134 "Hello World" =~ m!World!; # matches, delimited by '!'
135 "Hello World" =~ m{World}; # matches, note the matching '{}'
136 "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
137 # '/' becomes an ordinary char
138
139 "/World/", "m!World!", and "m{World}" all represent the same thing.
140 When, e.g., the quote ('"') is used as a delimiter, the forward slash
141 '/' becomes an ordinary character and can be used in this regexp
142 without trouble.
143
144 Let's consider how different regexps would match "Hello World":
145
146 "Hello World" =~ /world/; # doesn't match
147 "Hello World" =~ /o W/; # matches
148 "Hello World" =~ /oW/; # doesn't match
149 "Hello World" =~ /World /; # doesn't match
150
151 The first regexp "world" doesn't match because regexps are case-
152 sensitive. The second regexp matches because the substring 'o W'
153 occurs in the string "Hello World". The space character ' ' is treated
154 like any other character in a regexp and is needed to match in this
155 case. The lack of a space character is the reason the third regexp
156 'oW' doesn't match. The fourth regexp ""World "" doesn't match because
157 there is a space at the end of the regexp, but not at the end of the
158 string. The lesson here is that regexps must match a part of the
159 string exactly in order for the statement to be true.
160
161 If a regexp matches in more than one place in the string, Perl will
162 always match at the earliest possible point in the string:
163
164 "Hello World" =~ /o/; # matches 'o' in 'Hello'
165 "That hat is red" =~ /hat/; # matches 'hat' in 'That'
166
167 With respect to character matching, there are a few more points you
168 need to know about. First of all, not all characters can be used "as
169 is" in a match. Some characters, called metacharacters, are generally
170 reserved for use in regexp notation. The metacharacters are
171
172 {}[]()^$.|*+?-#\
173
174 This list is not as definitive as it may appear (or be claimed to be in
175 other documentation). For example, "#" is a metacharacter only when
176 the "/x" pattern modifier (described below) is used, and both "}" and
177 "]" are metacharacters only when paired with opening "{" or "["
178 respectively; other gotchas apply.
179
180 The significance of each of these will be explained in the rest of the
181 tutorial, but for now, it is important only to know that a
182 metacharacter can be matched as-is by putting a backslash before it:
183
184 "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
185 "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
186 "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
187 "The interval is [0,1)." =~ /\[0,1\)\./ # matches
188 "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/; # matches
189
190 In the last regexp, the forward slash '/' is also backslashed, because
191 it is used to delimit the regexp. This can lead to LTS (leaning
192 toothpick syndrome), however, and it is often more readable to change
193 delimiters.
194
195 "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!; # easier to read
196
197 The backslash character '\' is a metacharacter itself and needs to be
198 backslashed:
199
200 'C:\WIN32' =~ /C:\\WIN/; # matches
201
202 In situations where it doesn't make sense for a particular
203 metacharacter to mean what it normally does, it automatically loses its
204 metacharacter-ness and becomes an ordinary character that is to be
205 matched literally. For example, the '}' is a metacharacter only when
206 it is the mate of a '{' metacharacter. Otherwise it is treated as a
207 literal RIGHT CURLY BRACKET. This may lead to unexpected results.
208 "use re 'strict'" can catch some of these.
209
210 In addition to the metacharacters, there are some ASCII characters
211 which don't have printable character equivalents and are instead
212 represented by escape sequences. Common examples are "\t" for a tab,
213 "\n" for a newline, "\r" for a carriage return and "\a" for a bell (or
214 alert). If your string is better thought of as a sequence of arbitrary
215 bytes, the octal escape sequence, e.g., "\033", or hexadecimal escape
216 sequence, e.g., "\x1B" may be a more natural representation for your
217 bytes. Here are some examples of escapes:
218
219 "1000\t2000" =~ m(0\t2) # matches
220 "1000\n2000" =~ /0\n20/ # matches
221 "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
222 "cat" =~ /\o{143}\x61\x74/ # matches in ASCII, but a weird way
223 # to spell cat
224
225 If you've been around Perl a while, all this talk of escape sequences
226 may seem familiar. Similar escape sequences are used in double-quoted
227 strings and in fact the regexps in Perl are mostly treated as double-
228 quoted strings. This means that variables can be used in regexps as
229 well. Just like double-quoted strings, the values of the variables in
230 the regexp will be substituted in before the regexp is evaluated for
231 matching purposes. So we have:
232
233 $foo = 'house';
234 'housecat' =~ /$foo/; # matches
235 'cathouse' =~ /cat$foo/; # matches
236 'housecat' =~ /${foo}cat/; # matches
237
238 So far, so good. With the knowledge above you can already perform
239 searches with just about any literal string regexp you can dream up.
240 Here is a very simple emulation of the Unix grep program:
241
242 % cat > simple_grep
243 #!/usr/bin/perl
244 $regexp = shift;
245 while (<>) {
246 print if /$regexp/;
247 }
248 ^D
249
250 % chmod +x simple_grep
251
252 % simple_grep abba /usr/dict/words
253 Babbage
254 cabbage
255 cabbages
256 sabbath
257 Sabbathize
258 Sabbathizes
259 sabbatical
260 scabbard
261 scabbards
262
263 This program is easy to understand. "#!/usr/bin/perl" is the standard
264 way to invoke a perl program from the shell. "$regexp = shift;" saves
265 the first command line argument as the regexp to be used, leaving the
266 rest of the command line arguments to be treated as files.
267 "while (<>)" loops over all the lines in all the files. For each line,
268 "print if /$regexp/;" prints the line if the regexp matches the line.
269 In this line, both "print" and "/$regexp/" use the default variable $_
270 implicitly.
271
272 With all of the regexps above, if the regexp matched anywhere in the
273 string, it was considered a match. Sometimes, however, we'd like to
274 specify where in the string the regexp should try to match. To do
275 this, we would use the anchor metacharacters '^' and '$'. The anchor
276 '^' means match at the beginning of the string and the anchor '$' means
277 match at the end of the string, or before a newline at the end of the
278 string. Here is how they are used:
279
280 "housekeeper" =~ /keeper/; # matches
281 "housekeeper" =~ /^keeper/; # doesn't match
282 "housekeeper" =~ /keeper$/; # matches
283 "housekeeper\n" =~ /keeper$/; # matches
284
285 The second regexp doesn't match because '^' constrains "keeper" to
286 match only at the beginning of the string, but "housekeeper" has keeper
287 starting in the middle. The third regexp does match, since the '$'
288 constrains "keeper" to match only at the end of the string.
289
290 When both '^' and '$' are used at the same time, the regexp has to
291 match both the beginning and the end of the string, i.e., the regexp
292 matches the whole string. Consider
293
294 "keeper" =~ /^keep$/; # doesn't match
295 "keeper" =~ /^keeper$/; # matches
296 "" =~ /^$/; # ^$ matches an empty string
297
298 The first regexp doesn't match because the string has more to it than
299 "keep". Since the second regexp is exactly the string, it matches.
300 Using both '^' and '$' in a regexp forces the complete string to match,
301 so it gives you complete control over which strings match and which
302 don't. Suppose you are looking for a fellow named bert, off in a
303 string by himself:
304
305 "dogbert" =~ /bert/; # matches, but not what you want
306
307 "dilbert" =~ /^bert/; # doesn't match, but ..
308 "bertram" =~ /^bert/; # matches, so still not good enough
309
310 "bertram" =~ /^bert$/; # doesn't match, good
311 "dilbert" =~ /^bert$/; # doesn't match, good
312 "bert" =~ /^bert$/; # matches, perfect
313
314 Of course, in the case of a literal string, one could just as easily
315 use the string comparison "$string eq 'bert'" and it would be more
316 efficient. The "^...$" regexp really becomes useful when we add in
317 the more powerful regexp tools below.
318
319 Using character classes
320 Although one can already do quite a lot with the literal string regexps
321 above, we've only scratched the surface of regular expression
322 technology. In this and subsequent sections we will introduce regexp
323 concepts (and associated metacharacter notations) that will allow a
324 regexp to represent not just a single character sequence, but a whole
325 class of them.
326
327 One such concept is that of a character class. A character class
328 allows a set of possible characters, rather than just a single
329 character, to match at a particular point in a regexp. You can define
330 your own custom character classes. These are denoted by brackets
331 "[...]", with the set of characters to be possibly matched inside.
332 Here are some examples:
333
334 /cat/; # matches 'cat'
335 /[bcr]at/; # matches 'bat, 'cat', or 'rat'
336 /item[0123456789]/; # matches 'item0' or ... or 'item9'
337 "abc" =~ /[cab]/; # matches 'a'
338
339 In the last statement, even though 'c' is the first character in the
340 class, 'a' matches because the first character position in the string
341 is the earliest point at which the regexp can match.
342
343 /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
344 # 'yes', 'Yes', 'YES', etc.
345
346 This regexp displays a common task: perform a case-insensitive match.
347 Perl provides a way of avoiding all those brackets by simply appending
348 an 'i' to the end of the match. Then "/[yY][eE][sS]/;" can be
349 rewritten as "/yes/i;". The 'i' stands for case-insensitive and is an
350 example of a modifier of the matching operation. We will meet other
351 modifiers later in the tutorial.
352
353 We saw in the section above that there were ordinary characters, which
354 represented themselves, and special characters, which needed a
355 backslash '\' to represent themselves. The same is true in a character
356 class, but the sets of ordinary and special characters inside a
357 character class are different than those outside a character class.
358 The special characters for a character class are "-]\^$" (and the
359 pattern delimiter, whatever it is). ']' is special because it denotes
360 the end of a character class. '$' is special because it denotes a
361 scalar variable. '\' is special because it is used in escape
362 sequences, just like above. Here is how the special characters "]$\"
363 are handled:
364
365 /[\]c]def/; # matches ']def' or 'cdef'
366 $x = 'bcr';
367 /[$x]at/; # matches 'bat', 'cat', or 'rat'
368 /[\$x]at/; # matches '$at' or 'xat'
369 /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
370
371 The last two are a little tricky. In "[\$x]", the backslash protects
372 the dollar sign, so the character class has two members '$' and 'x'.
373 In "[\\$x]", the backslash is protected, so $x is treated as a variable
374 and substituted in double quote fashion.
375
376 The special character '-' acts as a range operator within character
377 classes, so that a contiguous set of characters can be written as a
378 range. With ranges, the unwieldy "[0123456789]" and "[abc...xyz]"
379 become the svelte "[0-9]" and "[a-z]". Some examples are
380
381 /item[0-9]/; # matches 'item0' or ... or 'item9'
382 /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
383 # 'baa', 'xaa', 'yaa', or 'zaa'
384 /[0-9a-fA-F]/; # matches a hexadecimal digit
385 /[0-9a-zA-Z_]/; # matches a "word" character,
386 # like those in a Perl variable name
387
388 If '-' is the first or last character in a character class, it is
389 treated as an ordinary character; "[-ab]", "[ab-]" and "[a\-b]" are all
390 equivalent.
391
392 The special character '^' in the first position of a character class
393 denotes a negated character class, which matches any character but
394 those in the brackets. Both "[...]" and "[^...]" must match a
395 character, or the match fails. Then
396
397 /[^a]at/; # doesn't match 'aat' or 'at', but matches
398 # all other 'bat', 'cat, '0at', '%at', etc.
399 /[^0-9]/; # matches a non-numeric character
400 /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
401
402 Now, even "[0-9]" can be a bother to write multiple times, so in the
403 interest of saving keystrokes and making regexps more readable, Perl
404 has several abbreviations for common character classes, as shown below.
405 Since the introduction of Unicode, unless the "/a" modifier is in
406 effect, these character classes match more than just a few characters
407 in the ASCII range.
408
409 · "\d" matches a digit, not just "[0-9]" but also digits from non-
410 roman scripts
411
412 · "\s" matches a whitespace character, the set "[\ \t\r\n\f]" and
413 others
414
415 · "\w" matches a word character (alphanumeric or '_'), not just
416 "[0-9a-zA-Z_]" but also digits and characters from non-roman
417 scripts
418
419 · "\D" is a negated "\d"; it represents any other character than a
420 digit, or "[^\d]"
421
422 · "\S" is a negated "\s"; it represents any non-whitespace character
423 "[^\s]"
424
425 · "\W" is a negated "\w"; it represents any non-word character
426 "[^\w]"
427
428 · The period '.' matches any character but "\n" (unless the modifier
429 "/s" is in effect, as explained below).
430
431 · "\N", like the period, matches any character but "\n", but it does
432 so regardless of whether the modifier "/s" is in effect.
433
434 The "/a" modifier, available starting in Perl 5.14, is used to
435 restrict the matches of "\d", "\s", and "\w" to just those in the ASCII
436 range. It is useful to keep your program from being needlessly exposed
437 to full Unicode (and its accompanying security considerations) when all
438 you want is to process English-like text. (The "a" may be doubled,
439 "/aa", to provide even more restrictions, preventing case-insensitive
440 matching of ASCII with non-ASCII characters; otherwise a Unicode
441 "Kelvin Sign" would caselessly match a "k" or "K".)
442
443 The "\d\s\w\D\S\W" abbreviations can be used both inside and outside of
444 bracketed character classes. Here are some in use:
445
446 /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
447 /[\d\s]/; # matches any digit or whitespace character
448 /\w\W\w/; # matches a word char, followed by a
449 # non-word char, followed by a word char
450 /..rt/; # matches any two chars, followed by 'rt'
451 /end\./; # matches 'end.'
452 /end[.]/; # same thing, matches 'end.'
453
454 Because a period is a metacharacter, it needs to be escaped to match as
455 an ordinary period. Because, for example, "\d" and "\w" are sets of
456 characters, it is incorrect to think of "[^\d\w]" as "[\D\W]"; in fact
457 "[^\d\w]" is the same as "[^\w]", which is the same as "[\W]". Think
458 DeMorgan's laws.
459
460 In actuality, the period and "\d\s\w\D\S\W" abbreviations are
461 themselves types of character classes, so the ones surrounded by
462 brackets are just one type of character class. When we need to make a
463 distinction, we refer to them as "bracketed character classes."
464
465 An anchor useful in basic regexps is the word anchor "\b". This
466 matches a boundary between a word character and a non-word character
467 "\w\W" or "\W\w":
468
469 $x = "Housecat catenates house and cat";
470 $x =~ /cat/; # matches cat in 'housecat'
471 $x =~ /\bcat/; # matches cat in 'catenates'
472 $x =~ /cat\b/; # matches cat in 'housecat'
473 $x =~ /\bcat\b/; # matches 'cat' at end of string
474
475 Note in the last example, the end of the string is considered a word
476 boundary.
477
478 For natural language processing (so that, for example, apostrophes are
479 included in words), use instead "\b{wb}"
480
481 "don't" =~ / .+? \b{wb} /x; # matches the whole string
482
483 You might wonder why '.' matches everything but "\n" - why not every
484 character? The reason is that often one is matching against lines and
485 would like to ignore the newline characters. For instance, while the
486 string "\n" represents one line, we would like to think of it as empty.
487 Then
488
489 "" =~ /^$/; # matches
490 "\n" =~ /^$/; # matches, $ anchors before "\n"
491
492 "" =~ /./; # doesn't match; it needs a char
493 "" =~ /^.$/; # doesn't match; it needs a char
494 "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
495 "a" =~ /^.$/; # matches
496 "a\n" =~ /^.$/; # matches, $ anchors before "\n"
497
498 This behavior is convenient, because we usually want to ignore newlines
499 when we count and match characters in a line. Sometimes, however, we
500 want to keep track of newlines. We might even want '^' and '$' to
501 anchor at the beginning and end of lines within the string, rather than
502 just the beginning and end of the string. Perl allows us to choose
503 between ignoring and paying attention to newlines by using the "/s" and
504 "/m" modifiers. "/s" and "/m" stand for single line and multi-line and
505 they determine whether a string is to be treated as one continuous
506 string, or as a set of lines. The two modifiers affect two aspects of
507 how the regexp is interpreted: 1) how the '.' character class is
508 defined, and 2) where the anchors '^' and '$' are able to match. Here
509 are the four possible combinations:
510
511 · no modifiers: Default behavior. '.' matches any character except
512 "\n". '^' matches only at the beginning of the string and '$'
513 matches only at the end or before a newline at the end.
514
515 · s modifier ("/s"): Treat string as a single long line. '.' matches
516 any character, even "\n". '^' matches only at the beginning of the
517 string and '$' matches only at the end or before a newline at the
518 end.
519
520 · m modifier ("/m"): Treat string as a set of multiple lines. '.'
521 matches any character except "\n". '^' and '$' are able to match
522 at the start or end of any line within the string.
523
524 · both s and m modifiers ("/sm"): Treat string as a single long line,
525 but detect multiple lines. '.' matches any character, even "\n".
526 '^' and '$', however, are able to match at the start or end of any
527 line within the string.
528
529 Here are examples of "/s" and "/m" in action:
530
531 $x = "There once was a girl\nWho programmed in Perl\n";
532
533 $x =~ /^Who/; # doesn't match, "Who" not at start of string
534 $x =~ /^Who/s; # doesn't match, "Who" not at start of string
535 $x =~ /^Who/m; # matches, "Who" at start of second line
536 $x =~ /^Who/sm; # matches, "Who" at start of second line
537
538 $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
539 $x =~ /girl.Who/s; # matches, "." matches "\n"
540 $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
541 $x =~ /girl.Who/sm; # matches, "." matches "\n"
542
543 Most of the time, the default behavior is what is wanted, but "/s" and
544 "/m" are occasionally very useful. If "/m" is being used, the start of
545 the string can still be matched with "\A" and the end of the string can
546 still be matched with the anchors "\Z" (matches both the end and the
547 newline before, like '$'), and "\z" (matches only the end):
548
549 $x =~ /^Who/m; # matches, "Who" at start of second line
550 $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
551
552 $x =~ /girl$/m; # matches, "girl" at end of first line
553 $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
554
555 $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
556 $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
557
558 We now know how to create choices among classes of characters in a
559 regexp. What about choices among words or character strings? Such
560 choices are described in the next section.
561
562 Matching this or that
563 Sometimes we would like our regexp to be able to match different
564 possible words or character strings. This is accomplished by using the
565 alternation metacharacter '|'. To match "dog" or "cat", we form the
566 regexp "dog|cat". As before, Perl will try to match the regexp at the
567 earliest possible point in the string. At each character position,
568 Perl will first try to match the first alternative, "dog". If "dog"
569 doesn't match, Perl will then try the next alternative, "cat". If
570 "cat" doesn't match either, then the match fails and Perl moves to the
571 next position in the string. Some examples:
572
573 "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
574 "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
575
576 Even though "dog" is the first alternative in the second regexp, "cat"
577 is able to match earlier in the string.
578
579 "cats" =~ /c|ca|cat|cats/; # matches "c"
580 "cats" =~ /cats|cat|ca|c/; # matches "cats"
581
582 Here, all the alternatives match at the first string position, so the
583 first alternative is the one that matches. If some of the alternatives
584 are truncations of the others, put the longest ones first to give them
585 a chance to match.
586
587 "cab" =~ /a|b|c/ # matches "c"
588 # /a|b|c/ == /[abc]/
589
590 The last example points out that character classes are like
591 alternations of characters. At a given character position, the first
592 alternative that allows the regexp match to succeed will be the one
593 that matches.
594
595 Grouping things and hierarchical matching
596 Alternation allows a regexp to choose among alternatives, but by itself
597 it is unsatisfying. The reason is that each alternative is a whole
598 regexp, but sometime we want alternatives for just part of a regexp.
599 For instance, suppose we want to search for housecats or housekeepers.
600 The regexp "housecat|housekeeper" fits the bill, but is inefficient
601 because we had to type "house" twice. It would be nice to have parts
602 of the regexp be constant, like "house", and some parts have
603 alternatives, like "cat|keeper".
604
605 The grouping metacharacters "()" solve this problem. Grouping allows
606 parts of a regexp to be treated as a single unit. Parts of a regexp
607 are grouped by enclosing them in parentheses. Thus we could solve the
608 "housecat|housekeeper" by forming the regexp as "house(cat|keeper)".
609 The regexp "house(cat|keeper)" means match "house" followed by either
610 "cat" or "keeper". Some more examples are
611
612 /(a|b)b/; # matches 'ab' or 'bb'
613 /(ac|b)b/; # matches 'acb' or 'bb'
614 /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
615 /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
616
617 /house(cat|)/; # matches either 'housecat' or 'house'
618 /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
619 # 'house'. Note groups can be nested.
620
621 /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
622 "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
623 # because '20\d\d' can't match
624
625 Alternations behave the same way in groups as out of them: at a given
626 string position, the leftmost alternative that allows the regexp to
627 match is taken. So in the last example at the first string position,
628 "20" matches the second alternative, but there is nothing left over to
629 match the next two digits "\d\d". So Perl moves on to the next
630 alternative, which is the null alternative and that works, since "20"
631 is two digits.
632
633 The process of trying one alternative, seeing if it matches, and moving
634 on to the next alternative, while going back in the string from where
635 the previous alternative was tried, if it doesn't, is called
636 backtracking. The term "backtracking" comes from the idea that
637 matching a regexp is like a walk in the woods. Successfully matching a
638 regexp is like arriving at a destination. There are many possible
639 trailheads, one for each string position, and each one is tried in
640 order, left to right. From each trailhead there may be many paths,
641 some of which get you there, and some which are dead ends. When you
642 walk along a trail and hit a dead end, you have to backtrack along the
643 trail to an earlier point to try another trail. If you hit your
644 destination, you stop immediately and forget about trying all the other
645 trails. You are persistent, and only if you have tried all the trails
646 from all the trailheads and not arrived at your destination, do you
647 declare failure. To be concrete, here is a step-by-step analysis of
648 what Perl does when it tries to match the regexp
649
650 "abcde" =~ /(abd|abc)(df|d|de)/;
651
652 0. Start with the first letter in the string 'a'.
653
654
655 1. Try the first alternative in the first group 'abd'.
656
657
658 2. Match 'a' followed by 'b'. So far so good.
659
660
661 3. 'd' in the regexp doesn't match 'c' in the string - a dead end. So
662 backtrack two characters and pick the second alternative in the first
663 group 'abc'.
664
665
666 4. Match 'a' followed by 'b' followed by 'c'. We are on a roll and
667 have satisfied the first group. Set $1 to 'abc'.
668
669
670 5 Move on to the second group and pick the first alternative 'df'.
671
672
673 6 Match the 'd'.
674
675
676 7. 'f' in the regexp doesn't match 'e' in the string, so a dead end.
677 Backtrack one character and pick the second alternative in the second
678 group 'd'.
679
680
681 8. 'd' matches. The second grouping is satisfied, so set $2 to 'd'.
682
683
684 9. We are at the end of the regexp, so we are done! We have matched
685 'abcd' out of the string "abcde".
686
687 There are a couple of things to note about this analysis. First, the
688 third alternative in the second group 'de' also allows a match, but we
689 stopped before we got to it - at a given character position, leftmost
690 wins. Second, we were able to get a match at the first character
691 position of the string 'a'. If there were no matches at the first
692 position, Perl would move to the second character position 'b' and
693 attempt the match all over again. Only when all possible paths at all
694 possible character positions have been exhausted does Perl give up and
695 declare "$string =~ /(abd|abc)(df|d|de)/;" to be false.
696
697 Even with all this work, regexp matching happens remarkably fast. To
698 speed things up, Perl compiles the regexp into a compact sequence of
699 opcodes that can often fit inside a processor cache. When the code is
700 executed, these opcodes can then run at full throttle and search very
701 quickly.
702
703 Extracting matches
704 The grouping metacharacters "()" also serve another completely
705 different function: they allow the extraction of the parts of a string
706 that matched. This is very useful to find out what matched and for
707 text processing in general. For each grouping, the part that matched
708 inside goes into the special variables $1, $2, etc. They can be used
709 just as ordinary variables:
710
711 # extract hours, minutes, seconds
712 if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
713 $hours = $1;
714 $minutes = $2;
715 $seconds = $3;
716 }
717
718 Now, we know that in scalar context, "$time =~ /(\d\d):(\d\d):(\d\d)/"
719 returns a true or false value. In list context, however, it returns
720 the list of matched values "($1,$2,$3)". So we could write the code
721 more compactly as
722
723 # extract hours, minutes, seconds
724 ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
725
726 If the groupings in a regexp are nested, $1 gets the group with the
727 leftmost opening parenthesis, $2 the next opening parenthesis, etc.
728 Here is a regexp with nested groups:
729
730 /(ab(cd|ef)((gi)|j))/;
731 1 2 34
732
733 If this regexp matches, $1 contains a string starting with 'ab', $2 is
734 either set to 'cd' or 'ef', $3 equals either 'gi' or 'j', and $4 is
735 either set to 'gi', just like $3, or it remains undefined.
736
737 For convenience, Perl sets $+ to the string held by the highest
738 numbered $1, $2,... that got assigned (and, somewhat related, $^N to
739 the value of the $1, $2,... most-recently assigned; i.e. the $1, $2,...
740 associated with the rightmost closing parenthesis used in the match).
741
742 Backreferences
743 Closely associated with the matching variables $1, $2, ... are the
744 backreferences "\g1", "\g2",... Backreferences are simply matching
745 variables that can be used inside a regexp. This is a really nice
746 feature; what matches later in a regexp is made to depend on what
747 matched earlier in the regexp. Suppose we wanted to look for doubled
748 words in a text, like "the the". The following regexp finds all
749 3-letter doubles with a space in between:
750
751 /\b(\w\w\w)\s\g1\b/;
752
753 The grouping assigns a value to "\g1", so that the same 3-letter
754 sequence is used for both parts.
755
756 A similar task is to find words consisting of two identical parts:
757
758 % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
759 beriberi
760 booboo
761 coco
762 mama
763 murmur
764 papa
765
766 The regexp has a single grouping which considers 4-letter combinations,
767 then 3-letter combinations, etc., and uses "\g1" to look for a repeat.
768 Although $1 and "\g1" represent the same thing, care should be taken to
769 use matched variables $1, $2,... only outside a regexp and
770 backreferences "\g1", "\g2",... only inside a regexp; not doing so may
771 lead to surprising and unsatisfactory results.
772
773 Relative backreferences
774 Counting the opening parentheses to get the correct number for a
775 backreference is error-prone as soon as there is more than one
776 capturing group. A more convenient technique became available with
777 Perl 5.10: relative backreferences. To refer to the immediately
778 preceding capture group one now may write "\g{-1}", the next but last
779 is available via "\g{-2}", and so on.
780
781 Another good reason in addition to readability and maintainability for
782 using relative backreferences is illustrated by the following example,
783 where a simple pattern for matching peculiar strings is used:
784
785 $a99a = '([a-z])(\d)\g2\g1'; # matches a11a, g22g, x33x, etc.
786
787 Now that we have this pattern stored as a handy string, we might feel
788 tempted to use it as a part of some other pattern:
789
790 $line = "code=e99e";
791 if ($line =~ /^(\w+)=$a99a$/){ # unexpected behavior!
792 print "$1 is valid\n";
793 } else {
794 print "bad line: '$line'\n";
795 }
796
797 But this doesn't match, at least not the way one might expect. Only
798 after inserting the interpolated $a99a and looking at the resulting
799 full text of the regexp is it obvious that the backreferences have
800 backfired. The subexpression "(\w+)" has snatched number 1 and demoted
801 the groups in $a99a by one rank. This can be avoided by using relative
802 backreferences:
803
804 $a99a = '([a-z])(\d)\g{-1}\g{-2}'; # safe for being interpolated
805
806 Named backreferences
807 Perl 5.10 also introduced named capture groups and named
808 backreferences. To attach a name to a capturing group, you write
809 either "(?<name>...)" or "(?'name'...)". The backreference may then be
810 written as "\g{name}". It is permissible to attach the same name to
811 more than one group, but then only the leftmost one of the eponymous
812 set can be referenced. Outside of the pattern a named capture group is
813 accessible through the "%+" hash.
814
815 Assuming that we have to match calendar dates which may be given in one
816 of the three formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write
817 three suitable patterns where we use 'd', 'm' and 'y' respectively as
818 the names of the groups capturing the pertaining components of a date.
819 The matching operation combines the three patterns as alternatives:
820
821 $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
822 $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
823 $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
824 for my $d (qw(2006-10-21 15.01.2007 10/31/2005)) {
825 if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
826 print "day=$+{d} month=$+{m} year=$+{y}\n";
827 }
828 }
829
830 If any of the alternatives matches, the hash "%+" is bound to contain
831 the three key-value pairs.
832
833 Alternative capture group numbering
834 Yet another capturing group numbering technique (also as from Perl
835 5.10) deals with the problem of referring to groups within a set of
836 alternatives. Consider a pattern for matching a time of the day, civil
837 or military style:
838
839 if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
840 # process hour and minute
841 }
842
843 Processing the results requires an additional if statement to determine
844 whether $1 and $2 or $3 and $4 contain the goodies. It would be easier
845 if we could use group numbers 1 and 2 in second alternative as well,
846 and this is exactly what the parenthesized construct "(?|...)", set
847 around an alternative achieves. Here is an extended version of the
848 previous pattern:
849
850 if($time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/){
851 print "hour=$1 minute=$2 zone=$3\n";
852 }
853
854 Within the alternative numbering group, group numbers start at the same
855 position for each alternative. After the group, numbering continues
856 with one higher than the maximum reached across all the alternatives.
857
858 Position information
859 In addition to what was matched, Perl also provides the positions of
860 what was matched as contents of the "@-" and "@+" arrays. "$-[0]" is
861 the position of the start of the entire match and $+[0] is the position
862 of the end. Similarly, "$-[n]" is the position of the start of the $n
863 match and $+[n] is the position of the end. If $n is undefined, so are
864 "$-[n]" and $+[n]. Then this code
865
866 $x = "Mmm...donut, thought Homer";
867 $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
868 foreach $exp (1..$#-) {
869 print "Match $exp: '${$exp}' at position ($-[$exp],$+[$exp])\n";
870 }
871
872 prints
873
874 Match 1: 'Mmm' at position (0,3)
875 Match 2: 'donut' at position (6,11)
876
877 Even if there are no groupings in a regexp, it is still possible to
878 find out what exactly matched in a string. If you use them, Perl will
879 set "$`" to the part of the string before the match, will set $& to the
880 part of the string that matched, and will set '$' to the part of the
881 string after the match. An example:
882
883 $x = "the cat caught the mouse";
884 $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
885 $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
886
887 In the second match, "$`" equals '' because the regexp matched at the
888 first character position in the string and stopped; it never saw the
889 second "the".
890
891 If your code is to run on Perl versions earlier than 5.20, it is
892 worthwhile to note that using "$`" and '$' slows down regexp matching
893 quite a bit, while $& slows it down to a lesser extent, because if they
894 are used in one regexp in a program, they are generated for all regexps
895 in the program. So if raw performance is a goal of your application,
896 they should be avoided. If you need to extract the corresponding
897 substrings, use "@-" and "@+" instead:
898
899 $` is the same as substr( $x, 0, $-[0] )
900 $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
901 $' is the same as substr( $x, $+[0] )
902
903 As of Perl 5.10, the "${^PREMATCH}", "${^MATCH}" and "${^POSTMATCH}"
904 variables may be used. These are only set if the "/p" modifier is
905 present. Consequently they do not penalize the rest of the program.
906 In Perl 5.20, "${^PREMATCH}", "${^MATCH}" and "${^POSTMATCH}" are
907 available whether the "/p" has been used or not (the modifier is
908 ignored), and "$`", '$' and $& do not cause any speed difference.
909
910 Non-capturing groupings
911 A group that is required to bundle a set of alternatives may or may not
912 be useful as a capturing group. If it isn't, it just creates a
913 superfluous addition to the set of available capture group values,
914 inside as well as outside the regexp. Non-capturing groupings, denoted
915 by "(?:regexp)", still allow the regexp to be treated as a single unit,
916 but don't establish a capturing group at the same time. Both capturing
917 and non-capturing groupings are allowed to co-exist in the same regexp.
918 Because there is no extraction, non-capturing groupings are faster than
919 capturing groupings. Non-capturing groupings are also handy for
920 choosing exactly which parts of a regexp are to be extracted to
921 matching variables:
922
923 # match a number, $1-$4 are set, but we only want $1
924 /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
925
926 # match a number faster , only $1 is set
927 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
928
929 # match a number, get $1 = whole number, $2 = exponent
930 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
931
932 Non-capturing groupings are also useful for removing nuisance elements
933 gathered from a split operation where parentheses are required for some
934 reason:
935
936 $x = '12aba34ba5';
937 @num = split /(a|b)+/, $x; # @num = ('12','a','34','a','5')
938 @num = split /(?:a|b)+/, $x; # @num = ('12','34','5')
939
940 In Perl 5.22 and later, all groups within a regexp can be set to non-
941 capturing by using the new "/n" flag:
942
943 "hello" =~ /(hi|hello)/n; # $1 is not set!
944
945 See "n" in perlre for more information.
946
947 Matching repetitions
948 The examples in the previous section display an annoying weakness. We
949 were only matching 3-letter words, or chunks of words of 4 letters or
950 less. We'd like to be able to match words or, more generally, strings
951 of any length, without writing out tedious alternatives like
952 "\w\w\w\w|\w\w\w|\w\w|\w".
953
954 This is exactly the problem the quantifier metacharacters '?', '*',
955 '+', and "{}" were created for. They allow us to delimit the number of
956 repeats for a portion of a regexp we consider to be a match.
957 Quantifiers are put immediately after the character, character class,
958 or grouping that we want to specify. They have the following meanings:
959
960 · "a?" means: match 'a' 1 or 0 times
961
962 · "a*" means: match 'a' 0 or more times, i.e., any number of times
963
964 · "a+" means: match 'a' 1 or more times, i.e., at least once
965
966 · "a{n,m}" means: match at least "n" times, but not more than "m"
967 times.
968
969 · "a{n,}" means: match at least "n" or more times
970
971 · "a{n}" means: match exactly "n" times
972
973 Here are some examples:
974
975 /[a-z]+\s+\d*/; # match a lowercase word, at least one space, and
976 # any number of digits
977 /(\w+)\s+\g1/; # match doubled words of arbitrary length
978 /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
979 $year =~ /^\d{2,4}$/; # make sure year is at least 2 but not more
980 # than 4 digits
981 $year =~ /^\d{4}$|^\d{2}$/; # better match; throw out 3-digit dates
982 $year =~ /^\d{2}(\d{2})?$/; # same thing written differently.
983 # However, this captures the last two
984 # digits in $1 and the other does not.
985
986 % simple_grep '^(\w+)\g1$' /usr/dict/words # isn't this easier?
987 beriberi
988 booboo
989 coco
990 mama
991 murmur
992 papa
993
994 For all of these quantifiers, Perl will try to match as much of the
995 string as possible, while still allowing the regexp to succeed. Thus
996 with "/a?.../", Perl will first try to match the regexp with the 'a'
997 present; if that fails, Perl will try to match the regexp without the
998 'a' present. For the quantifier '*', we get the following:
999
1000 $x = "the cat in the hat";
1001 $x =~ /^(.*)(cat)(.*)$/; # matches,
1002 # $1 = 'the '
1003 # $2 = 'cat'
1004 # $3 = ' in the hat'
1005
1006 Which is what we might expect, the match finds the only "cat" in the
1007 string and locks onto it. Consider, however, this regexp:
1008
1009 $x =~ /^(.*)(at)(.*)$/; # matches,
1010 # $1 = 'the cat in the h'
1011 # $2 = 'at'
1012 # $3 = '' (0 characters match)
1013
1014 One might initially guess that Perl would find the "at" in "cat" and
1015 stop there, but that wouldn't give the longest possible string to the
1016 first quantifier ".*". Instead, the first quantifier ".*" grabs as
1017 much of the string as possible while still having the regexp match. In
1018 this example, that means having the "at" sequence with the final "at"
1019 in the string. The other important principle illustrated here is that,
1020 when there are two or more elements in a regexp, the leftmost
1021 quantifier, if there is one, gets to grab as much of the string as
1022 possible, leaving the rest of the regexp to fight over scraps. Thus in
1023 our example, the first quantifier ".*" grabs most of the string, while
1024 the second quantifier ".*" gets the empty string. Quantifiers that
1025 grab as much of the string as possible are called maximal match or
1026 greedy quantifiers.
1027
1028 When a regexp can match a string in several different ways, we can use
1029 the principles above to predict which way the regexp will match:
1030
1031 · Principle 0: Taken as a whole, any regexp will be matched at the
1032 earliest possible position in the string.
1033
1034 · Principle 1: In an alternation "a|b|c...", the leftmost alternative
1035 that allows a match for the whole regexp will be the one used.
1036
1037 · Principle 2: The maximal matching quantifiers '?', '*', '+' and
1038 "{n,m}" will in general match as much of the string as possible
1039 while still allowing the whole regexp to match.
1040
1041 · Principle 3: If there are two or more elements in a regexp, the
1042 leftmost greedy quantifier, if any, will match as much of the
1043 string as possible while still allowing the whole regexp to match.
1044 The next leftmost greedy quantifier, if any, will try to match as
1045 much of the string remaining available to it as possible, while
1046 still allowing the whole regexp to match. And so on, until all the
1047 regexp elements are satisfied.
1048
1049 As we have seen above, Principle 0 overrides the others. The regexp
1050 will be matched as early as possible, with the other principles
1051 determining how the regexp matches at that earliest character position.
1052
1053 Here is an example of these principles in action:
1054
1055 $x = "The programming republic of Perl";
1056 $x =~ /^(.+)(e|r)(.*)$/; # matches,
1057 # $1 = 'The programming republic of Pe'
1058 # $2 = 'r'
1059 # $3 = 'l'
1060
1061 This regexp matches at the earliest string position, 'T'. One might
1062 think that 'e', being leftmost in the alternation, would be matched,
1063 but 'r' produces the longest string in the first quantifier.
1064
1065 $x =~ /(m{1,2})(.*)$/; # matches,
1066 # $1 = 'mm'
1067 # $2 = 'ing republic of Perl'
1068
1069 Here, The earliest possible match is at the first 'm' in "programming".
1070 "m{1,2}" is the first quantifier, so it gets to match a maximal "mm".
1071
1072 $x =~ /.*(m{1,2})(.*)$/; # matches,
1073 # $1 = 'm'
1074 # $2 = 'ing republic of Perl'
1075
1076 Here, the regexp matches at the start of the string. The first
1077 quantifier ".*" grabs as much as possible, leaving just a single 'm'
1078 for the second quantifier "m{1,2}".
1079
1080 $x =~ /(.?)(m{1,2})(.*)$/; # matches,
1081 # $1 = 'a'
1082 # $2 = 'mm'
1083 # $3 = 'ing republic of Perl'
1084
1085 Here, ".?" eats its maximal one character at the earliest possible
1086 position in the string, 'a' in "programming", leaving "m{1,2}" the
1087 opportunity to match both 'm''s. Finally,
1088
1089 "aXXXb" =~ /(X*)/; # matches with $1 = ''
1090
1091 because it can match zero copies of 'X' at the beginning of the string.
1092 If you definitely want to match at least one 'X', use "X+", not "X*".
1093
1094 Sometimes greed is not good. At times, we would like quantifiers to
1095 match a minimal piece of string, rather than a maximal piece. For this
1096 purpose, Larry Wall created the minimal match or non-greedy quantifiers
1097 "??", "*?", "+?", and "{}?". These are the usual quantifiers with a
1098 '?' appended to them. They have the following meanings:
1099
1100 · "a??" means: match 'a' 0 or 1 times. Try 0 first, then 1.
1101
1102 · "a*?" means: match 'a' 0 or more times, i.e., any number of times,
1103 but as few times as possible
1104
1105 · "a+?" means: match 'a' 1 or more times, i.e., at least once, but as
1106 few times as possible
1107
1108 · "a{n,m}?" means: match at least "n" times, not more than "m" times,
1109 as few times as possible
1110
1111 · "a{n,}?" means: match at least "n" times, but as few times as
1112 possible
1113
1114 · "a{n}?" means: match exactly "n" times. Because we match exactly
1115 "n" times, "a{n}?" is equivalent to "a{n}" and is just there for
1116 notational consistency.
1117
1118 Let's look at the example above, but with minimal quantifiers:
1119
1120 $x = "The programming republic of Perl";
1121 $x =~ /^(.+?)(e|r)(.*)$/; # matches,
1122 # $1 = 'Th'
1123 # $2 = 'e'
1124 # $3 = ' programming republic of Perl'
1125
1126 The minimal string that will allow both the start of the string '^' and
1127 the alternation to match is "Th", with the alternation "e|r" matching
1128 'e'. The second quantifier ".*" is free to gobble up the rest of the
1129 string.
1130
1131 $x =~ /(m{1,2}?)(.*?)$/; # matches,
1132 # $1 = 'm'
1133 # $2 = 'ming republic of Perl'
1134
1135 The first string position that this regexp can match is at the first
1136 'm' in "programming". At this position, the minimal "m{1,2}?" matches
1137 just one 'm'. Although the second quantifier ".*?" would prefer to
1138 match no characters, it is constrained by the end-of-string anchor '$'
1139 to match the rest of the string.
1140
1141 $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
1142 # $1 = 'The progra'
1143 # $2 = 'm'
1144 # $3 = 'ming republic of Perl'
1145
1146 In this regexp, you might expect the first minimal quantifier ".*?" to
1147 match the empty string, because it is not constrained by a '^' anchor
1148 to match the beginning of the word. Principle 0 applies here, however.
1149 Because it is possible for the whole regexp to match at the start of
1150 the string, it will match at the start of the string. Thus the first
1151 quantifier has to match everything up to the first 'm'. The second
1152 minimal quantifier matches just one 'm' and the third quantifier
1153 matches the rest of the string.
1154
1155 $x =~ /(.??)(m{1,2})(.*)$/; # matches,
1156 # $1 = 'a'
1157 # $2 = 'mm'
1158 # $3 = 'ing republic of Perl'
1159
1160 Just as in the previous regexp, the first quantifier ".??" can match
1161 earliest at position 'a', so it does. The second quantifier is greedy,
1162 so it matches "mm", and the third matches the rest of the string.
1163
1164 We can modify principle 3 above to take into account non-greedy
1165 quantifiers:
1166
1167 · Principle 3: If there are two or more elements in a regexp, the
1168 leftmost greedy (non-greedy) quantifier, if any, will match as much
1169 (little) of the string as possible while still allowing the whole
1170 regexp to match. The next leftmost greedy (non-greedy) quantifier,
1171 if any, will try to match as much (little) of the string remaining
1172 available to it as possible, while still allowing the whole regexp
1173 to match. And so on, until all the regexp elements are satisfied.
1174
1175 Just like alternation, quantifiers are also susceptible to
1176 backtracking. Here is a step-by-step analysis of the example
1177
1178 $x = "the cat in the hat";
1179 $x =~ /^(.*)(at)(.*)$/; # matches,
1180 # $1 = 'the cat in the h'
1181 # $2 = 'at'
1182 # $3 = '' (0 matches)
1183
1184 0. Start with the first letter in the string 't'.
1185
1186
1187 1. The first quantifier '.*' starts out by matching the whole string
1188 ""the cat in the hat"".
1189
1190
1191 2. 'a' in the regexp element 'at' doesn't match the end of the string.
1192 Backtrack one character.
1193
1194
1195 3. 'a' in the regexp element 'at' still doesn't match the last letter
1196 of the string 't', so backtrack one more character.
1197
1198
1199 4. Now we can match the 'a' and the 't'.
1200
1201
1202 5. Move on to the third element '.*'. Since we are at the end of the
1203 string and '.*' can match 0 times, assign it the empty string.
1204
1205
1206 6. We are done!
1207
1208 Most of the time, all this moving forward and backtracking happens
1209 quickly and searching is fast. There are some pathological regexps,
1210 however, whose execution time exponentially grows with the size of the
1211 string. A typical structure that blows up in your face is of the form
1212
1213 /(a|b+)*/;
1214
1215 The problem is the nested indeterminate quantifiers. There are many
1216 different ways of partitioning a string of length n between the '+' and
1217 '*': one repetition with "b+" of length n, two repetitions with the
1218 first "b+" length k and the second with length n-k, m repetitions whose
1219 bits add up to length n, etc. In fact there are an exponential number
1220 of ways to partition a string as a function of its length. A regexp
1221 may get lucky and match early in the process, but if there is no match,
1222 Perl will try every possibility before giving up. So be careful with
1223 nested '*''s, "{n,m}"'s, and '+''s. The book Mastering Regular
1224 Expressions by Jeffrey Friedl gives a wonderful discussion of this and
1225 other efficiency issues.
1226
1227 Possessive quantifiers
1228 Backtracking during the relentless search for a match may be a waste of
1229 time, particularly when the match is bound to fail. Consider the
1230 simple pattern
1231
1232 /^\w+\s+\w+$/; # a word, spaces, a word
1233
1234 Whenever this is applied to a string which doesn't quite meet the
1235 pattern's expectations such as "abc " or "abc def ", the regexp
1236 engine will backtrack, approximately once for each character in the
1237 string. But we know that there is no way around taking all of the
1238 initial word characters to match the first repetition, that all spaces
1239 must be eaten by the middle part, and the same goes for the second
1240 word.
1241
1242 With the introduction of the possessive quantifiers in Perl 5.10, we
1243 have a way of instructing the regexp engine not to backtrack, with the
1244 usual quantifiers with a '+' appended to them. This makes them greedy
1245 as well as stingy; once they succeed they won't give anything back to
1246 permit another solution. They have the following meanings:
1247
1248 · "a{n,m}+" means: match at least "n" times, not more than "m" times,
1249 as many times as possible, and don't give anything up. "a?+" is
1250 short for "a{0,1}+"
1251
1252 · "a{n,}+" means: match at least "n" times, but as many times as
1253 possible, and don't give anything up. "a*+" is short for "a{0,}+"
1254 and "a++" is short for "a{1,}+".
1255
1256 · "a{n}+" means: match exactly "n" times. It is just there for
1257 notational consistency.
1258
1259 These possessive quantifiers represent a special case of a more general
1260 concept, the independent subexpression, see below.
1261
1262 As an example where a possessive quantifier is suitable we consider
1263 matching a quoted string, as it appears in several programming
1264 languages. The backslash is used as an escape character that indicates
1265 that the next character is to be taken literally, as another character
1266 for the string. Therefore, after the opening quote, we expect a
1267 (possibly empty) sequence of alternatives: either some character except
1268 an unescaped quote or backslash or an escaped character.
1269
1270 /"(?:[^"\\]++|\\.)*+"/;
1271
1272 Building a regexp
1273 At this point, we have all the basic regexp concepts covered, so let's
1274 give a more involved example of a regular expression. We will build a
1275 regexp that matches numbers.
1276
1277 The first task in building a regexp is to decide what we want to match
1278 and what we want to exclude. In our case, we want to match both
1279 integers and floating point numbers and we want to reject any string
1280 that isn't a number.
1281
1282 The next task is to break the problem down into smaller problems that
1283 are easily converted into a regexp.
1284
1285 The simplest case is integers. These consist of a sequence of digits,
1286 with an optional sign in front. The digits we can represent with "\d+"
1287 and the sign can be matched with "[+-]". Thus the integer regexp is
1288
1289 /[+-]?\d+/; # matches integers
1290
1291 A floating point number potentially has a sign, an integral part, a
1292 decimal point, a fractional part, and an exponent. One or more of
1293 these parts is optional, so we need to check out the different
1294 possibilities. Floating point numbers which are in proper form include
1295 123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
1296 front is completely optional and can be matched by "[+-]?". We can see
1297 that if there is no exponent, floating point numbers must have a
1298 decimal point, otherwise they are integers. We might be tempted to
1299 model these with "\d*\.\d*", but this would also match just a single
1300 decimal point, which is not a number. So the three cases of floating
1301 point number without exponent are
1302
1303 /[+-]?\d+\./; # 1., 321., etc.
1304 /[+-]?\.\d+/; # .1, .234, etc.
1305 /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
1306
1307 These can be combined into a single regexp with a three-way
1308 alternation:
1309
1310 /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
1311
1312 In this alternation, it is important to put '\d+\.\d+' before '\d+\.'.
1313 If '\d+\.' were first, the regexp would happily match that and ignore
1314 the fractional part of the number.
1315
1316 Now consider floating point numbers with exponents. The key
1317 observation here is that both integers and numbers with decimal points
1318 are allowed in front of an exponent. Then exponents, like the overall
1319 sign, are independent of whether we are matching numbers with or
1320 without decimal points, and can be "decoupled" from the mantissa. The
1321 overall form of the regexp now becomes clear:
1322
1323 /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
1324
1325 The exponent is an 'e' or 'E', followed by an integer. So the exponent
1326 regexp is
1327
1328 /[eE][+-]?\d+/; # exponent
1329
1330 Putting all the parts together, we get a regexp that matches numbers:
1331
1332 /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
1333
1334 Long regexps like this may impress your friends, but can be hard to
1335 decipher. In complex situations like this, the "/x" modifier for a
1336 match is invaluable. It allows one to put nearly arbitrary whitespace
1337 and comments into a regexp without affecting their meaning. Using it,
1338 we can rewrite our "extended" regexp in the more pleasing form
1339
1340 /^
1341 [+-]? # first, match an optional sign
1342 ( # then match integers or f.p. mantissas:
1343 \d+\.\d+ # mantissa of the form a.b
1344 |\d+\. # mantissa of the form a.
1345 |\.\d+ # mantissa of the form .b
1346 |\d+ # integer of the form a
1347 )
1348 ( [eE] [+-]? \d+ )? # finally, optionally match an exponent
1349 $/x;
1350
1351 If whitespace is mostly irrelevant, how does one include space
1352 characters in an extended regexp? The answer is to backslash it '\ ' or
1353 put it in a character class "[ ]". The same thing goes for pound
1354 signs: use "\#" or "[#]". For instance, Perl allows a space between
1355 the sign and the mantissa or integer, and we could add this to our
1356 regexp as follows:
1357
1358 /^
1359 [+-]?\ * # first, match an optional sign *and space*
1360 ( # then match integers or f.p. mantissas:
1361 \d+\.\d+ # mantissa of the form a.b
1362 |\d+\. # mantissa of the form a.
1363 |\.\d+ # mantissa of the form .b
1364 |\d+ # integer of the form a
1365 )
1366 ( [eE] [+-]? \d+ )? # finally, optionally match an exponent
1367 $/x;
1368
1369 In this form, it is easier to see a way to simplify the alternation.
1370 Alternatives 1, 2, and 4 all start with "\d+", so it could be factored
1371 out:
1372
1373 /^
1374 [+-]?\ * # first, match an optional sign
1375 ( # then match integers or f.p. mantissas:
1376 \d+ # start out with a ...
1377 (
1378 \.\d* # mantissa of the form a.b or a.
1379 )? # ? takes care of integers of the form a
1380 |\.\d+ # mantissa of the form .b
1381 )
1382 ( [eE] [+-]? \d+ )? # finally, optionally match an exponent
1383 $/x;
1384
1385 Starting in Perl v5.26, specifying "/xx" changes the square-bracketed
1386 portions of a pattern to ignore tabs and space characters unless they
1387 are escaped by preceding them with a backslash. So, we could write
1388
1389 /^
1390 [ + - ]?\ * # first, match an optional sign
1391 ( # then match integers or f.p. mantissas:
1392 \d+ # start out with a ...
1393 (
1394 \.\d* # mantissa of the form a.b or a.
1395 )? # ? takes care of integers of the form a
1396 |\.\d+ # mantissa of the form .b
1397 )
1398 ( [ e E ] [ + - ]? \d+ )? # finally, optionally match an exponent
1399 $/xx;
1400
1401 This doesn't really improve the legibility of this example, but it's
1402 available in case you want it. Squashing the pattern down to the
1403 compact form, we have
1404
1405 /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
1406
1407 This is our final regexp. To recap, we built a regexp by
1408
1409 · specifying the task in detail,
1410
1411 · breaking down the problem into smaller parts,
1412
1413 · translating the small parts into regexps,
1414
1415 · combining the regexps,
1416
1417 · and optimizing the final combined regexp.
1418
1419 These are also the typical steps involved in writing a computer
1420 program. This makes perfect sense, because regular expressions are
1421 essentially programs written in a little computer language that
1422 specifies patterns.
1423
1424 Using regular expressions in Perl
1425 The last topic of Part 1 briefly covers how regexps are used in Perl
1426 programs. Where do they fit into Perl syntax?
1427
1428 We have already introduced the matching operator in its default
1429 "/regexp/" and arbitrary delimiter "m!regexp!" forms. We have used the
1430 binding operator "=~" and its negation "!~" to test for string matches.
1431 Associated with the matching operator, we have discussed the single
1432 line "/s", multi-line "/m", case-insensitive "/i" and extended "/x"
1433 modifiers. There are a few more things you might want to know about
1434 matching operators.
1435
1436 Prohibiting substitution
1437
1438 If you change $pattern after the first substitution happens, Perl will
1439 ignore it. If you don't want any substitutions at all, use the special
1440 delimiter "m''":
1441
1442 @pattern = ('Seuss');
1443 while (<>) {
1444 print if m'@pattern'; # matches literal '@pattern', not 'Seuss'
1445 }
1446
1447 Similar to strings, "m''" acts like apostrophes on a regexp; all other
1448 'm' delimiters act like quotes. If the regexp evaluates to the empty
1449 string, the regexp in the last successful match is used instead. So we
1450 have
1451
1452 "dog" =~ /d/; # 'd' matches
1453 "dogbert =~ //; # this matches the 'd' regexp used before
1454
1455 Global matching
1456
1457 The final two modifiers we will discuss here, "/g" and "/c", concern
1458 multiple matches. The modifier "/g" stands for global matching and
1459 allows the matching operator to match within a string as many times as
1460 possible. In scalar context, successive invocations against a string
1461 will have "/g" jump from match to match, keeping track of position in
1462 the string as it goes along. You can get or set the position with the
1463 "pos()" function.
1464
1465 The use of "/g" is shown in the following example. Suppose we have a
1466 string that consists of words separated by spaces. If we know how many
1467 words there are in advance, we could extract the words using groupings:
1468
1469 $x = "cat dog house"; # 3 words
1470 $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
1471 # $1 = 'cat'
1472 # $2 = 'dog'
1473 # $3 = 'house'
1474
1475 But what if we had an indeterminate number of words? This is the sort
1476 of task "/g" was made for. To extract all words, form the simple
1477 regexp "(\w+)" and loop over all matches with "/(\w+)/g":
1478
1479 while ($x =~ /(\w+)/g) {
1480 print "Word is $1, ends at position ", pos $x, "\n";
1481 }
1482
1483 prints
1484
1485 Word is cat, ends at position 3
1486 Word is dog, ends at position 7
1487 Word is house, ends at position 13
1488
1489 A failed match or changing the target string resets the position. If
1490 you don't want the position reset after failure to match, add the "/c",
1491 as in "/regexp/gc". The current position in the string is associated
1492 with the string, not the regexp. This means that different strings
1493 have different positions and their respective positions can be set or
1494 read independently.
1495
1496 In list context, "/g" returns a list of matched groupings, or if there
1497 are no groupings, a list of matches to the whole regexp. So if we
1498 wanted just the words, we could use
1499
1500 @words = ($x =~ /(\w+)/g); # matches,
1501 # $words[0] = 'cat'
1502 # $words[1] = 'dog'
1503 # $words[2] = 'house'
1504
1505 Closely associated with the "/g" modifier is the "\G" anchor. The "\G"
1506 anchor matches at the point where the previous "/g" match left off.
1507 "\G" allows us to easily do context-sensitive matching:
1508
1509 $metric = 1; # use metric units
1510 ...
1511 $x = <FILE>; # read in measurement
1512 $x =~ /^([+-]?\d+)\s*/g; # get magnitude
1513 $weight = $1;
1514 if ($metric) { # error checking
1515 print "Units error!" unless $x =~ /\Gkg\./g;
1516 }
1517 else {
1518 print "Units error!" unless $x =~ /\Glbs\./g;
1519 }
1520 $x =~ /\G\s+(widget|sprocket)/g; # continue processing
1521
1522 The combination of "/g" and "\G" allows us to process the string a bit
1523 at a time and use arbitrary Perl logic to decide what to do next.
1524 Currently, the "\G" anchor is only fully supported when used to anchor
1525 to the start of the pattern.
1526
1527 "\G" is also invaluable in processing fixed-length records with
1528 regexps. Suppose we have a snippet of coding region DNA, encoded as
1529 base pair letters "ATCGTTGAAT..." and we want to find all the stop
1530 codons "TGA". In a coding region, codons are 3-letter sequences, so we
1531 can think of the DNA snippet as a sequence of 3-letter records. The
1532 naive regexp
1533
1534 # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
1535 $dna = "ATCGTTGAATGCAAATGACATGAC";
1536 $dna =~ /TGA/;
1537
1538 doesn't work; it may match a "TGA", but there is no guarantee that the
1539 match is aligned with codon boundaries, e.g., the substring "GTT GAA"
1540 gives a match. A better solution is
1541
1542 while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
1543 print "Got a TGA stop codon at position ", pos $dna, "\n";
1544 }
1545
1546 which prints
1547
1548 Got a TGA stop codon at position 18
1549 Got a TGA stop codon at position 23
1550
1551 Position 18 is good, but position 23 is bogus. What happened?
1552
1553 The answer is that our regexp works well until we get past the last
1554 real match. Then the regexp will fail to match a synchronized "TGA"
1555 and start stepping ahead one character position at a time, not what we
1556 want. The solution is to use "\G" to anchor the match to the codon
1557 alignment:
1558
1559 while ($dna =~ /\G(\w\w\w)*?TGA/g) {
1560 print "Got a TGA stop codon at position ", pos $dna, "\n";
1561 }
1562
1563 This prints
1564
1565 Got a TGA stop codon at position 18
1566
1567 which is the correct answer. This example illustrates that it is
1568 important not only to match what is desired, but to reject what is not
1569 desired.
1570
1571 (There are other regexp modifiers that are available, such as "/o", but
1572 their specialized uses are beyond the scope of this introduction. )
1573
1574 Search and replace
1575
1576 Regular expressions also play a big role in search and replace
1577 operations in Perl. Search and replace is accomplished with the "s///"
1578 operator. The general form is "s/regexp/replacement/modifiers", with
1579 everything we know about regexps and modifiers applying in this case as
1580 well. The replacement is a Perl double-quoted string that replaces in
1581 the string whatever is matched with the "regexp". The operator "=~" is
1582 also used here to associate a string with "s///". If matching against
1583 $_, the "$_ =~" can be dropped. If there is a match, "s///" returns
1584 the number of substitutions made; otherwise it returns false. Here are
1585 a few examples:
1586
1587 $x = "Time to feed the cat!";
1588 $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
1589 if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
1590 $more_insistent = 1;
1591 }
1592 $y = "'quoted words'";
1593 $y =~ s/^'(.*)'$/$1/; # strip single quotes,
1594 # $y contains "quoted words"
1595
1596 In the last example, the whole string was matched, but only the part
1597 inside the single quotes was grouped. With the "s///" operator, the
1598 matched variables $1, $2, etc. are immediately available for use in the
1599 replacement expression, so we use $1 to replace the quoted string with
1600 just what was quoted. With the global modifier, "s///g" will search
1601 and replace all occurrences of the regexp in the string:
1602
1603 $x = "I batted 4 for 4";
1604 $x =~ s/4/four/; # doesn't do it all:
1605 # $x contains "I batted four for 4"
1606 $x = "I batted 4 for 4";
1607 $x =~ s/4/four/g; # does it all:
1608 # $x contains "I batted four for four"
1609
1610 If you prefer "regex" over "regexp" in this tutorial, you could use the
1611 following program to replace it:
1612
1613 % cat > simple_replace
1614 #!/usr/bin/perl
1615 $regexp = shift;
1616 $replacement = shift;
1617 while (<>) {
1618 s/$regexp/$replacement/g;
1619 print;
1620 }
1621 ^D
1622
1623 % simple_replace regexp regex perlretut.pod
1624
1625 In "simple_replace" we used the "s///g" modifier to replace all
1626 occurrences of the regexp on each line. (Even though the regular
1627 expression appears in a loop, Perl is smart enough to compile it only
1628 once.) As with "simple_grep", both the "print" and the
1629 "s/$regexp/$replacement/g" use $_ implicitly.
1630
1631 If you don't want "s///" to change your original variable you can use
1632 the non-destructive substitute modifier, "s///r". This changes the
1633 behavior so that "s///r" returns the final substituted string (instead
1634 of the number of substitutions):
1635
1636 $x = "I like dogs.";
1637 $y = $x =~ s/dogs/cats/r;
1638 print "$x $y\n";
1639
1640 That example will print "I like dogs. I like cats". Notice the original
1641 $x variable has not been affected. The overall result of the
1642 substitution is instead stored in $y. If the substitution doesn't
1643 affect anything then the original string is returned:
1644
1645 $x = "I like dogs.";
1646 $y = $x =~ s/elephants/cougars/r;
1647 print "$x $y\n"; # prints "I like dogs. I like dogs."
1648
1649 One other interesting thing that the "s///r" flag allows is chaining
1650 substitutions:
1651
1652 $x = "Cats are great.";
1653 print $x =~ s/Cats/Dogs/r =~ s/Dogs/Frogs/r =~
1654 s/Frogs/Hedgehogs/r, "\n";
1655 # prints "Hedgehogs are great."
1656
1657 A modifier available specifically to search and replace is the "s///e"
1658 evaluation modifier. "s///e" treats the replacement text as Perl code,
1659 rather than a double-quoted string. The value that the code returns is
1660 substituted for the matched substring. "s///e" is useful if you need
1661 to do a bit of computation in the process of replacing text. This
1662 example counts character frequencies in a line:
1663
1664 $x = "Bill the cat";
1665 $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
1666 print "frequency of '$_' is $chars{$_}\n"
1667 foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
1668
1669 This prints
1670
1671 frequency of ' ' is 2
1672 frequency of 't' is 2
1673 frequency of 'l' is 2
1674 frequency of 'B' is 1
1675 frequency of 'c' is 1
1676 frequency of 'e' is 1
1677 frequency of 'h' is 1
1678 frequency of 'i' is 1
1679 frequency of 'a' is 1
1680
1681 As with the match "m//" operator, "s///" can use other delimiters, such
1682 as "s!!!" and "s{}{}", and even "s{}//". If single quotes are used
1683 "s'''", then the regexp and replacement are treated as single-quoted
1684 strings and there are no variable substitutions. "s///" in list
1685 context returns the same thing as in scalar context, i.e., the number
1686 of matches.
1687
1688 The split function
1689
1690 The "split()" function is another place where a regexp is used. "split
1691 /regexp/, string, limit" separates the "string" operand into a list of
1692 substrings and returns that list. The regexp must be designed to match
1693 whatever constitutes the separators for the desired substrings. The
1694 "limit", if present, constrains splitting into no more than "limit"
1695 number of strings. For example, to split a string into words, use
1696
1697 $x = "Calvin and Hobbes";
1698 @words = split /\s+/, $x; # $word[0] = 'Calvin'
1699 # $word[1] = 'and'
1700 # $word[2] = 'Hobbes'
1701
1702 If the empty regexp "//" is used, the regexp always matches and the
1703 string is split into individual characters. If the regexp has
1704 groupings, then the resulting list contains the matched substrings from
1705 the groupings as well. For instance,
1706
1707 $x = "/usr/bin/perl";
1708 @dirs = split m!/!, $x; # $dirs[0] = ''
1709 # $dirs[1] = 'usr'
1710 # $dirs[2] = 'bin'
1711 # $dirs[3] = 'perl'
1712 @parts = split m!(/)!, $x; # $parts[0] = ''
1713 # $parts[1] = '/'
1714 # $parts[2] = 'usr'
1715 # $parts[3] = '/'
1716 # $parts[4] = 'bin'
1717 # $parts[5] = '/'
1718 # $parts[6] = 'perl'
1719
1720 Since the first character of $x matched the regexp, "split" prepended
1721 an empty initial element to the list.
1722
1723 If you have read this far, congratulations! You now have all the basic
1724 tools needed to use regular expressions to solve a wide range of text
1725 processing problems. If this is your first time through the tutorial,
1726 why not stop here and play around with regexps a while.... Part 2
1727 concerns the more esoteric aspects of regular expressions and those
1728 concepts certainly aren't needed right at the start.
1729
1731 OK, you know the basics of regexps and you want to know more. If
1732 matching regular expressions is analogous to a walk in the woods, then
1733 the tools discussed in Part 1 are analogous to topo maps and a compass,
1734 basic tools we use all the time. Most of the tools in part 2 are
1735 analogous to flare guns and satellite phones. They aren't used too
1736 often on a hike, but when we are stuck, they can be invaluable.
1737
1738 What follows are the more advanced, less used, or sometimes esoteric
1739 capabilities of Perl regexps. In Part 2, we will assume you are
1740 comfortable with the basics and concentrate on the advanced features.
1741
1742 More on characters, strings, and character classes
1743 There are a number of escape sequences and character classes that we
1744 haven't covered yet.
1745
1746 There are several escape sequences that convert characters or strings
1747 between upper and lower case, and they are also available within
1748 patterns. "\l" and "\u" convert the next character to lower or upper
1749 case, respectively:
1750
1751 $x = "perl";
1752 $string =~ /\u$x/; # matches 'Perl' in $string
1753 $x = "M(rs?|s)\\."; # note the double backslash
1754 $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
1755
1756 A "\L" or "\U" indicates a lasting conversion of case, until terminated
1757 by "\E" or thrown over by another "\U" or "\L":
1758
1759 $x = "This word is in lower case:\L SHOUT\E";
1760 $x =~ /shout/; # matches
1761 $x = "I STILL KEYPUNCH CARDS FOR MY 360"
1762 $x =~ /\Ukeypunch/; # matches punch card string
1763
1764 If there is no "\E", case is converted until the end of the string. The
1765 regexps "\L\u$word" or "\u\L$word" convert the first character of $word
1766 to uppercase and the rest of the characters to lowercase.
1767
1768 Control characters can be escaped with "\c", so that a control-Z
1769 character would be matched with "\cZ". The escape sequence "\Q"..."\E"
1770 quotes, or protects most non-alphabetic characters. For instance,
1771
1772 $x = "\QThat !^*&%~& cat!";
1773 $x =~ /\Q!^*&%~&\E/; # check for rough language
1774
1775 It does not protect '$' or '@', so that variables can still be
1776 substituted.
1777
1778 "\Q", "\L", "\l", "\U", "\u" and "\E" are actually part of double-
1779 quotish syntax, and not part of regexp syntax proper. They will work
1780 if they appear in a regular expression embedded directly in a program,
1781 but not when contained in a string that is interpolated in a pattern.
1782
1783 Perl regexps can handle more than just the standard ASCII character
1784 set. Perl supports Unicode, a standard for representing the alphabets
1785 from virtually all of the world's written languages, and a host of
1786 symbols. Perl's text strings are Unicode strings, so they can contain
1787 characters with a value (codepoint or character number) higher than
1788 255.
1789
1790 What does this mean for regexps? Well, regexp users don't need to know
1791 much about Perl's internal representation of strings. But they do need
1792 to know 1) how to represent Unicode characters in a regexp and 2) that
1793 a matching operation will treat the string to be searched as a sequence
1794 of characters, not bytes. The answer to 1) is that Unicode characters
1795 greater than "chr(255)" are represented using the "\x{hex}" notation,
1796 because "\x"XY (without curly braces and XY are two hex digits) doesn't
1797 go further than 255. (Starting in Perl 5.14, if you're an octal fan,
1798 you can also use "\o{oct}".)
1799
1800 /\x{263a}/; # match a Unicode smiley face :)
1801
1802 NOTE: In Perl 5.6.0 it used to be that one needed to say "use utf8" to
1803 use any Unicode features. This is no more the case: for almost all
1804 Unicode processing, the explicit "utf8" pragma is not needed. (The
1805 only case where it matters is if your Perl script is in Unicode and
1806 encoded in UTF-8, then an explicit "use utf8" is needed.)
1807
1808 Figuring out the hexadecimal sequence of a Unicode character you want
1809 or deciphering someone else's hexadecimal Unicode regexp is about as
1810 much fun as programming in machine code. So another way to specify
1811 Unicode characters is to use the named character escape sequence
1812 "\N{name}". name is a name for the Unicode character, as specified in
1813 the Unicode standard. For instance, if we wanted to represent or match
1814 the astrological sign for the planet Mercury, we could use
1815
1816 $x = "abc\N{MERCURY}def";
1817 $x =~ /\N{MERCURY}/; # matches
1818
1819 One can also use "short" names:
1820
1821 print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
1822 print "\N{greek:Sigma} is an upper-case sigma.\n";
1823
1824 You can also restrict names to a certain alphabet by specifying the
1825 charnames pragma:
1826
1827 use charnames qw(greek);
1828 print "\N{sigma} is Greek sigma\n";
1829
1830 An index of character names is available on-line from the Unicode
1831 Consortium, <http://www.unicode.org/charts/charindex.html>; explanatory
1832 material with links to other resources at
1833 <http://www.unicode.org/standard/where>.
1834
1835 The answer to requirement 2) is that a regexp (mostly) uses Unicode
1836 characters. The "mostly" is for messy backward compatibility reasons,
1837 but starting in Perl 5.14, any regexp compiled in the scope of a "use
1838 feature 'unicode_strings'" (which is automatically turned on within the
1839 scope of a "use 5.012" or higher) will turn that "mostly" into
1840 "always". If you want to handle Unicode properly, you should ensure
1841 that 'unicode_strings' is turned on. Internally, this is encoded to
1842 bytes using either UTF-8 or a native 8 bit encoding, depending on the
1843 history of the string, but conceptually it is a sequence of characters,
1844 not bytes. See perlunitut for a tutorial about that.
1845
1846 Let us now discuss Unicode character classes, most usually called
1847 "character properties". These are represented by the "\p{name}" escape
1848 sequence. The negation of this is "\P{name}". For example, to match
1849 lower and uppercase characters,
1850
1851 $x = "BOB";
1852 $x =~ /^\p{IsUpper}/; # matches, uppercase char class
1853 $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
1854 $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
1855 $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
1856
1857 (The ""Is"" is optional.)
1858
1859 There are many, many Unicode character properties. For the full list
1860 see perluniprops. Most of them have synonyms with shorter names, also
1861 listed there. Some synonyms are a single character. For these, you
1862 can drop the braces. For instance, "\pM" is the same thing as
1863 "\p{Mark}", meaning things like accent marks.
1864
1865 The Unicode "\p{Script}" and "\p{Script_Extensions}" properties are
1866 used to categorize every Unicode character into the language script it
1867 is written in. ("Script_Extensions" is an improved version of
1868 "Script", which is retained for backward compatibility, and so you
1869 should generally use "Script_Extensions".) For example, English,
1870 French, and a bunch of other European languages are written in the
1871 Latin script. But there is also the Greek script, the Thai script, the
1872 Katakana script, etc. You can test whether a character is in a
1873 particular script (based on "Script_Extensions") with, for example
1874 "\p{Latin}", "\p{Greek}", or "\p{Katakana}". To test if it isn't in
1875 the Balinese script, you would use "\P{Balinese}".
1876
1877 What we have described so far is the single form of the "\p{...}"
1878 character classes. There is also a compound form which you may run
1879 into. These look like "\p{name=value}" or "\p{name:value}" (the equals
1880 sign and colon can be used interchangeably). These are more general
1881 than the single form, and in fact most of the single forms are just
1882 Perl-defined shortcuts for common compound forms. For example, the
1883 script examples in the previous paragraph could be written equivalently
1884 as "\p{Script_Extensions=Latin}", "\p{Script_Extensions:Greek}",
1885 "\p{script_extensions=katakana}", and "\P{script_extensions=balinese}"
1886 (case is irrelevant between the "{}" braces). You may never have to
1887 use the compound forms, but sometimes it is necessary, and their use
1888 can make your code easier to understand.
1889
1890 "\X" is an abbreviation for a character class that comprises a Unicode
1891 extended grapheme cluster. This represents a "logical character": what
1892 appears to be a single character, but may be represented internally by
1893 more than one. As an example, using the Unicode full names, e.g.,
1894 "A + COMBINING RING" is a grapheme cluster with base character "A" and
1895 combining character "COMBINING RING, which translates in Danish to "A"
1896 with the circle atop it, as in the word Aangstrom.
1897
1898 For the full and latest information about Unicode see the latest
1899 Unicode standard, or the Unicode Consortium's website
1900 <http://www.unicode.org>
1901
1902 As if all those classes weren't enough, Perl also defines POSIX-style
1903 character classes. These have the form "[:name:]", with name the name
1904 of the POSIX class. The POSIX classes are "alpha", "alnum", "ascii",
1905 "cntrl", "digit", "graph", "lower", "print", "punct", "space", "upper",
1906 and "xdigit", and two extensions, "word" (a Perl extension to match
1907 "\w"), and "blank" (a GNU extension). The "/a" modifier restricts
1908 these to matching just in the ASCII range; otherwise they can match the
1909 same as their corresponding Perl Unicode classes: "[:upper:]" is the
1910 same as "\p{IsUpper}", etc. (There are some exceptions and gotchas
1911 with this; see perlrecharclass for a full discussion.) The "[:digit:]",
1912 "[:word:]", and "[:space:]" correspond to the familiar "\d", "\w", and
1913 "\s" character classes. To negate a POSIX class, put a '^' in front of
1914 the name, so that, e.g., "[:^digit:]" corresponds to "\D" and, under
1915 Unicode, "\P{IsDigit}". The Unicode and POSIX character classes can be
1916 used just like "\d", with the exception that POSIX character classes
1917 can only be used inside of a character class:
1918
1919 /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
1920 /^=item\s[[:digit:]]/; # match '=item',
1921 # followed by a space and a digit
1922 /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
1923 /^=item\s\p{IsDigit}/; # match '=item',
1924 # followed by a space and a digit
1925
1926 Whew! That is all the rest of the characters and character classes.
1927
1928 Compiling and saving regular expressions
1929 In Part 1 we mentioned that Perl compiles a regexp into a compact
1930 sequence of opcodes. Thus, a compiled regexp is a data structure that
1931 can be stored once and used again and again. The regexp quote "qr//"
1932 does exactly that: "qr/string/" compiles the "string" as a regexp and
1933 transforms the result into a form that can be assigned to a variable:
1934
1935 $reg = qr/foo+bar?/; # reg contains a compiled regexp
1936
1937 Then $reg can be used as a regexp:
1938
1939 $x = "fooooba";
1940 $x =~ $reg; # matches, just like /foo+bar?/
1941 $x =~ /$reg/; # same thing, alternate form
1942
1943 $reg can also be interpolated into a larger regexp:
1944
1945 $x =~ /(abc)?$reg/; # still matches
1946
1947 As with the matching operator, the regexp quote can use different
1948 delimiters, e.g., "qr!!", "qr{}" or "qr~~". Apostrophes as delimiters
1949 ("qr''") inhibit any interpolation.
1950
1951 Pre-compiled regexps are useful for creating dynamic matches that don't
1952 need to be recompiled each time they are encountered. Using pre-
1953 compiled regexps, we write a "grep_step" program which greps for a
1954 sequence of patterns, advancing to the next pattern as soon as one has
1955 been satisfied.
1956
1957 % cat > grep_step
1958 #!/usr/bin/perl
1959 # grep_step - match <number> regexps, one after the other
1960 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
1961
1962 $number = shift;
1963 $regexp[$_] = shift foreach (0..$number-1);
1964 @compiled = map qr/$_/, @regexp;
1965 while ($line = <>) {
1966 if ($line =~ /$compiled[0]/) {
1967 print $line;
1968 shift @compiled;
1969 last unless @compiled;
1970 }
1971 }
1972 ^D
1973
1974 % grep_step 3 shift print last grep_step
1975 $number = shift;
1976 print $line;
1977 last unless @compiled;
1978
1979 Storing pre-compiled regexps in an array @compiled allows us to simply
1980 loop through the regexps without any recompilation, thus gaining
1981 flexibility without sacrificing speed.
1982
1983 Composing regular expressions at runtime
1984 Backtracking is more efficient than repeated tries with different
1985 regular expressions. If there are several regular expressions and a
1986 match with any of them is acceptable, then it is possible to combine
1987 them into a set of alternatives. If the individual expressions are
1988 input data, this can be done by programming a join operation. We'll
1989 exploit this idea in an improved version of the "simple_grep" program:
1990 a program that matches multiple patterns:
1991
1992 % cat > multi_grep
1993 #!/usr/bin/perl
1994 # multi_grep - match any of <number> regexps
1995 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
1996
1997 $number = shift;
1998 $regexp[$_] = shift foreach (0..$number-1);
1999 $pattern = join '|', @regexp;
2000
2001 while ($line = <>) {
2002 print $line if $line =~ /$pattern/;
2003 }
2004 ^D
2005
2006 % multi_grep 2 shift for multi_grep
2007 $number = shift;
2008 $regexp[$_] = shift foreach (0..$number-1);
2009
2010 Sometimes it is advantageous to construct a pattern from the input that
2011 is to be analyzed and use the permissible values on the left hand side
2012 of the matching operations. As an example for this somewhat
2013 paradoxical situation, let's assume that our input contains a command
2014 verb which should match one out of a set of available command verbs,
2015 with the additional twist that commands may be abbreviated as long as
2016 the given string is unique. The program below demonstrates the basic
2017 algorithm.
2018
2019 % cat > keymatch
2020 #!/usr/bin/perl
2021 $kwds = 'copy compare list print';
2022 while( $cmd = <> ){
2023 $cmd =~ s/^\s+|\s+$//g; # trim leading and trailing spaces
2024 if( ( @matches = $kwds =~ /\b$cmd\w*/g ) == 1 ){
2025 print "command: '@matches'\n";
2026 } elsif( @matches == 0 ){
2027 print "no such command: '$cmd'\n";
2028 } else {
2029 print "not unique: '$cmd' (could be one of: @matches)\n";
2030 }
2031 }
2032 ^D
2033
2034 % keymatch
2035 li
2036 command: 'list'
2037 co
2038 not unique: 'co' (could be one of: copy compare)
2039 printer
2040 no such command: 'printer'
2041
2042 Rather than trying to match the input against the keywords, we match
2043 the combined set of keywords against the input. The pattern matching
2044 operation "$kwds =~ /\b($cmd\w*)/g" does several things at the same
2045 time. It makes sure that the given command begins where a keyword
2046 begins ("\b"). It tolerates abbreviations due to the added "\w*". It
2047 tells us the number of matches ("scalar @matches") and all the keywords
2048 that were actually matched. You could hardly ask for more.
2049
2050 Embedding comments and modifiers in a regular expression
2051 Starting with this section, we will be discussing Perl's set of
2052 extended patterns. These are extensions to the traditional regular
2053 expression syntax that provide powerful new tools for pattern matching.
2054 We have already seen extensions in the form of the minimal matching
2055 constructs "??", "*?", "+?", "{n,m}?", and "{n,}?". Most of the
2056 extensions below have the form "(?char...)", where the "char" is a
2057 character that determines the type of extension.
2058
2059 The first extension is an embedded comment "(?#text)". This embeds a
2060 comment into the regular expression without affecting its meaning. The
2061 comment should not have any closing parentheses in the text. An
2062 example is
2063
2064 /(?# Match an integer:)[+-]?\d+/;
2065
2066 This style of commenting has been largely superseded by the raw,
2067 freeform commenting that is allowed with the "/x" modifier.
2068
2069 Most modifiers, such as "/i", "/m", "/s" and "/x" (or any combination
2070 thereof) can also be embedded in a regexp using "(?i)", "(?m)", "(?s)",
2071 and "(?x)". For instance,
2072
2073 /(?i)yes/; # match 'yes' case insensitively
2074 /yes/i; # same thing
2075 /(?x)( # freeform version of an integer regexp
2076 [+-]? # match an optional sign
2077 \d+ # match a sequence of digits
2078 )
2079 /x;
2080
2081 Embedded modifiers can have two important advantages over the usual
2082 modifiers. Embedded modifiers allow a custom set of modifiers for each
2083 regexp pattern. This is great for matching an array of regexps that
2084 must have different modifiers:
2085
2086 $pattern[0] = '(?i)doctor';
2087 $pattern[1] = 'Johnson';
2088 ...
2089 while (<>) {
2090 foreach $patt (@pattern) {
2091 print if /$patt/;
2092 }
2093 }
2094
2095 The second advantage is that embedded modifiers (except "/p", which
2096 modifies the entire regexp) only affect the regexp inside the group the
2097 embedded modifier is contained in. So grouping can be used to localize
2098 the modifier's effects:
2099
2100 /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
2101
2102 Embedded modifiers can also turn off any modifiers already present by
2103 using, e.g., "(?-i)". Modifiers can also be combined into a single
2104 expression, e.g., "(?s-i)" turns on single line mode and turns off case
2105 insensitivity.
2106
2107 Embedded modifiers may also be added to a non-capturing grouping.
2108 "(?i-m:regexp)" is a non-capturing grouping that matches "regexp" case
2109 insensitively and turns off multi-line mode.
2110
2111 Looking ahead and looking behind
2112 This section concerns the lookahead and lookbehind assertions. First,
2113 a little background.
2114
2115 In Perl regular expressions, most regexp elements "eat up" a certain
2116 amount of string when they match. For instance, the regexp element
2117 "[abc]" eats up one character of the string when it matches, in the
2118 sense that Perl moves to the next character position in the string
2119 after the match. There are some elements, however, that don't eat up
2120 characters (advance the character position) if they match. The
2121 examples we have seen so far are the anchors. The anchor '^' matches
2122 the beginning of the line, but doesn't eat any characters. Similarly,
2123 the word boundary anchor "\b" matches wherever a character matching
2124 "\w" is next to a character that doesn't, but it doesn't eat up any
2125 characters itself. Anchors are examples of zero-width assertions:
2126 zero-width, because they consume no characters, and assertions, because
2127 they test some property of the string. In the context of our walk in
2128 the woods analogy to regexp matching, most regexp elements move us
2129 along a trail, but anchors have us stop a moment and check our
2130 surroundings. If the local environment checks out, we can proceed
2131 forward. But if the local environment doesn't satisfy us, we must
2132 backtrack.
2133
2134 Checking the environment entails either looking ahead on the trail,
2135 looking behind, or both. '^' looks behind, to see that there are no
2136 characters before. '$' looks ahead, to see that there are no
2137 characters after. "\b" looks both ahead and behind, to see if the
2138 characters on either side differ in their "word-ness".
2139
2140 The lookahead and lookbehind assertions are generalizations of the
2141 anchor concept. Lookahead and lookbehind are zero-width assertions
2142 that let us specify which characters we want to test for. The
2143 lookahead assertion is denoted by "(?=regexp)" and the lookbehind
2144 assertion is denoted by "(?<=fixed-regexp)". Some examples are
2145
2146 $x = "I catch the housecat 'Tom-cat' with catnip";
2147 $x =~ /cat(?=\s)/; # matches 'cat' in 'housecat'
2148 @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
2149 # $catwords[0] = 'catch'
2150 # $catwords[1] = 'catnip'
2151 $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
2152 $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
2153 # middle of $x
2154
2155 Note that the parentheses in "(?=regexp)" and "(?<=regexp)" are non-
2156 capturing, since these are zero-width assertions. Thus in the second
2157 regexp, the substrings captured are those of the whole regexp itself.
2158 Lookahead "(?=regexp)" can match arbitrary regexps, but lookbehind
2159 "(?<=fixed-regexp)" only works for regexps of fixed width, i.e., a
2160 fixed number of characters long. Thus "(?<=(ab|bc))" is fine, but
2161 "(?<=(ab)*)" is not. The negated versions of the lookahead and
2162 lookbehind assertions are denoted by "(?!regexp)" and
2163 "(?<!fixed-regexp)" respectively. They evaluate true if the regexps do
2164 not match:
2165
2166 $x = "foobar";
2167 $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
2168 $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
2169 $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
2170
2171 Here is an example where a string containing blank-separated words,
2172 numbers and single dashes is to be split into its components. Using
2173 "/\s+/" alone won't work, because spaces are not required between
2174 dashes, or a word or a dash. Additional places for a split are
2175 established by looking ahead and behind:
2176
2177 $str = "one two - --6-8";
2178 @toks = split / \s+ # a run of spaces
2179 | (?<=\S) (?=-) # any non-space followed by '-'
2180 | (?<=-) (?=\S) # a '-' followed by any non-space
2181 /x, $str; # @toks = qw(one two - - - 6 - 8)
2182
2183 Starting in Perl 5.28, experimentally, alphabetic equivalents to these
2184 assertions are added, so you can use whichever is most memorable for
2185 your tastes.
2186
2187 (?=...) (*pla:...) or (*positive_lookahead:...)
2188 (?!...) (*nla:...) or (*negative_lookahead:...)
2189 (?<=...) (*plb:...) or (*positive_lookbehind:...)
2190 (?<!...) (*nlb:...) or (*negative_lookbehind:...)
2191 (?>...) (*atomic:...)
2192
2193 Using any of these will raise (unless turned off) a warning in the
2194 "experimental::alpha_assertions" category.
2195
2196 Using independent subexpressions to prevent backtracking
2197 Independent subexpressions are regular expressions, in the context of a
2198 larger regular expression, that function independently of the larger
2199 regular expression. That is, they consume as much or as little of the
2200 string as they wish without regard for the ability of the larger regexp
2201 to match. Independent subexpressions are represented by "(?>regexp)".
2202 We can illustrate their behavior by first considering an ordinary
2203 regexp:
2204
2205 $x = "ab";
2206 $x =~ /a*ab/; # matches
2207
2208 This obviously matches, but in the process of matching, the
2209 subexpression "a*" first grabbed the 'a'. Doing so, however, wouldn't
2210 allow the whole regexp to match, so after backtracking, "a*" eventually
2211 gave back the 'a' and matched the empty string. Here, what "a*"
2212 matched was dependent on what the rest of the regexp matched.
2213
2214 Contrast that with an independent subexpression:
2215
2216 $x =~ /(?>a*)ab/; # doesn't match!
2217
2218 The independent subexpression "(?>a*)" doesn't care about the rest of
2219 the regexp, so it sees an 'a' and grabs it. Then the rest of the
2220 regexp "ab" cannot match. Because "(?>a*)" is independent, there is no
2221 backtracking and the independent subexpression does not give up its
2222 'a'. Thus the match of the regexp as a whole fails. A similar
2223 behavior occurs with completely independent regexps:
2224
2225 $x = "ab";
2226 $x =~ /a*/g; # matches, eats an 'a'
2227 $x =~ /\Gab/g; # doesn't match, no 'a' available
2228
2229 Here "/g" and "\G" create a "tag team" handoff of the string from one
2230 regexp to the other. Regexps with an independent subexpression are
2231 much like this, with a handoff of the string to the independent
2232 subexpression, and a handoff of the string back to the enclosing
2233 regexp.
2234
2235 The ability of an independent subexpression to prevent backtracking can
2236 be quite useful. Suppose we want to match a non-empty string enclosed
2237 in parentheses up to two levels deep. Then the following regexp
2238 matches:
2239
2240 $x = "abc(de(fg)h"; # unbalanced parentheses
2241 $x =~ /\( ( [ ^ () ]+ | \( [ ^ () ]* \) )+ \)/xx;
2242
2243 The regexp matches an open parenthesis, one or more copies of an
2244 alternation, and a close parenthesis. The alternation is two-way, with
2245 the first alternative "[^()]+" matching a substring with no parentheses
2246 and the second alternative "\([^()]*\)" matching a substring delimited
2247 by parentheses. The problem with this regexp is that it is
2248 pathological: it has nested indeterminate quantifiers of the form
2249 "(a+|b)+". We discussed in Part 1 how nested quantifiers like this
2250 could take an exponentially long time to execute if there was no match
2251 possible. To prevent the exponential blowup, we need to prevent
2252 useless backtracking at some point. This can be done by enclosing the
2253 inner quantifier as an independent subexpression:
2254
2255 $x =~ /\( ( (?> [ ^ () ]+ ) | \([ ^ () ]* \) )+ \)/xx;
2256
2257 Here, "(?>[^()]+)" breaks the degeneracy of string partitioning by
2258 gobbling up as much of the string as possible and keeping it. Then
2259 match failures fail much more quickly.
2260
2261 Conditional expressions
2262 A conditional expression is a form of if-then-else statement that
2263 allows one to choose which patterns are to be matched, based on some
2264 condition. There are two types of conditional expression:
2265 "(?(condition)yes-regexp)" and "(?(condition)yes-regexp|no-regexp)".
2266 "(?(condition)yes-regexp)" is like an 'if () {}' statement in Perl. If
2267 the condition is true, the yes-regexp will be matched. If the
2268 condition is false, the yes-regexp will be skipped and Perl will move
2269 onto the next regexp element. The second form is like an
2270 'if () {} else {}' statement in Perl. If the condition is true, the
2271 yes-regexp will be matched, otherwise the no-regexp will be matched.
2272
2273 The condition can have several forms. The first form is simply an
2274 integer in parentheses "(integer)". It is true if the corresponding
2275 backreference "\integer" matched earlier in the regexp. The same thing
2276 can be done with a name associated with a capture group, written as
2277 "(<name>)" or "('name')". The second form is a bare zero-width
2278 assertion "(?...)", either a lookahead, a lookbehind, or a code
2279 assertion (discussed in the next section). The third set of forms
2280 provides tests that return true if the expression is executed within a
2281 recursion ("(R)") or is being called from some capturing group,
2282 referenced either by number ("(R1)", "(R2)",...) or by name
2283 ("(R&name)").
2284
2285 The integer or name form of the "condition" allows us to choose, with
2286 more flexibility, what to match based on what matched earlier in the
2287 regexp. This searches for words of the form "$x$x" or "$x$y$y$x":
2288
2289 % simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
2290 beriberi
2291 coco
2292 couscous
2293 deed
2294 ...
2295 toot
2296 toto
2297 tutu
2298
2299 The lookbehind "condition" allows, along with backreferences, an
2300 earlier part of the match to influence a later part of the match. For
2301 instance,
2302
2303 /[ATGC]+(?(?<=AA)G|C)$/;
2304
2305 matches a DNA sequence such that it either ends in "AAG", or some other
2306 base pair combination and 'C'. Note that the form is "(?(?<=AA)G|C)"
2307 and not "(?((?<=AA))G|C)"; for the lookahead, lookbehind or code
2308 assertions, the parentheses around the conditional are not needed.
2309
2310 Defining named patterns
2311 Some regular expressions use identical subpatterns in several places.
2312 Starting with Perl 5.10, it is possible to define named subpatterns in
2313 a section of the pattern so that they can be called up by name anywhere
2314 in the pattern. This syntactic pattern for this definition group is
2315 "(?(DEFINE)(?<name>pattern)...)". An insertion of a named pattern is
2316 written as "(?&name)".
2317
2318 The example below illustrates this feature using the pattern for
2319 floating point numbers that was presented earlier on. The three
2320 subpatterns that are used more than once are the optional sign, the
2321 digit sequence for an integer and the decimal fraction. The "DEFINE"
2322 group at the end of the pattern contains their definition. Notice that
2323 the decimal fraction pattern is the first place where we can reuse the
2324 integer pattern.
2325
2326 /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
2327 (?: [eE](?&osg)(?&int) )?
2328 $
2329 (?(DEFINE)
2330 (?<osg>[-+]?) # optional sign
2331 (?<int>\d++) # integer
2332 (?<dec>\.(?&int)) # decimal fraction
2333 )/x
2334
2335 Recursive patterns
2336 This feature (introduced in Perl 5.10) significantly extends the power
2337 of Perl's pattern matching. By referring to some other capture group
2338 anywhere in the pattern with the construct "(?group-ref)", the pattern
2339 within the referenced group is used as an independent subpattern in
2340 place of the group reference itself. Because the group reference may
2341 be contained within the group it refers to, it is now possible to apply
2342 pattern matching to tasks that hitherto required a recursive parser.
2343
2344 To illustrate this feature, we'll design a pattern that matches if a
2345 string contains a palindrome. (This is a word or a sentence that, while
2346 ignoring spaces, interpunctuation and case, reads the same backwards as
2347 forwards. We begin by observing that the empty string or a string
2348 containing just one word character is a palindrome. Otherwise it must
2349 have a word character up front and the same at its end, with another
2350 palindrome in between.
2351
2352 /(?: (\w) (?...Here be a palindrome...) \g{-1} | \w? )/x
2353
2354 Adding "\W*" at either end to eliminate what is to be ignored, we
2355 already have the full pattern:
2356
2357 my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
2358 for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
2359 print "'$s' is a palindrome\n" if $s =~ /$pp/;
2360 }
2361
2362 In "(?...)" both absolute and relative backreferences may be used. The
2363 entire pattern can be reinserted with "(?R)" or "(?0)". If you prefer
2364 to name your groups, you can use "(?&name)" to recurse into that group.
2365
2366 A bit of magic: executing Perl code in a regular expression
2367 Normally, regexps are a part of Perl expressions. Code evaluation
2368 expressions turn that around by allowing arbitrary Perl code to be a
2369 part of a regexp. A code evaluation expression is denoted "(?{code})",
2370 with code a string of Perl statements.
2371
2372 Code expressions are zero-width assertions, and the value they return
2373 depends on their environment. There are two possibilities: either the
2374 code expression is used as a conditional in a conditional expression
2375 "(?(condition)...)", or it is not. If the code expression is a
2376 conditional, the code is evaluated and the result (i.e., the result of
2377 the last statement) is used to determine truth or falsehood. If the
2378 code expression is not used as a conditional, the assertion always
2379 evaluates true and the result is put into the special variable $^R.
2380 The variable $^R can then be used in code expressions later in the
2381 regexp. Here are some silly examples:
2382
2383 $x = "abcdef";
2384 $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
2385 # prints 'Hi Mom!'
2386 $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
2387 # no 'Hi Mom!'
2388
2389 Pay careful attention to the next example:
2390
2391 $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
2392 # no 'Hi Mom!'
2393 # but why not?
2394
2395 At first glance, you'd think that it shouldn't print, because obviously
2396 the "ddd" isn't going to match the target string. But look at this
2397 example:
2398
2399 $x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
2400 # but _does_ print
2401
2402 Hmm. What happened here? If you've been following along, you know that
2403 the above pattern should be effectively (almost) the same as the last
2404 one; enclosing the 'd' in a character class isn't going to change what
2405 it matches. So why does the first not print while the second one does?
2406
2407 The answer lies in the optimizations the regexp engine makes. In the
2408 first case, all the engine sees are plain old characters (aside from
2409 the "?{}" construct). It's smart enough to realize that the string
2410 'ddd' doesn't occur in our target string before actually running the
2411 pattern through. But in the second case, we've tricked it into thinking
2412 that our pattern is more complicated. It takes a look, sees our
2413 character class, and decides that it will have to actually run the
2414 pattern to determine whether or not it matches, and in the process of
2415 running it hits the print statement before it discovers that we don't
2416 have a match.
2417
2418 To take a closer look at how the engine does optimizations, see the
2419 section "Pragmas and debugging" below.
2420
2421 More fun with "?{}":
2422
2423 $x =~ /(?{print "Hi Mom!";})/; # matches,
2424 # prints 'Hi Mom!'
2425 $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
2426 # prints '1'
2427 $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
2428 # prints '1'
2429
2430 The bit of magic mentioned in the section title occurs when the regexp
2431 backtracks in the process of searching for a match. If the regexp
2432 backtracks over a code expression and if the variables used within are
2433 localized using "local", the changes in the variables produced by the
2434 code expression are undone! Thus, if we wanted to count how many times
2435 a character got matched inside a group, we could use, e.g.,
2436
2437 $x = "aaaa";
2438 $count = 0; # initialize 'a' count
2439 $c = "bob"; # test if $c gets clobbered
2440 $x =~ /(?{local $c = 0;}) # initialize count
2441 ( a # match 'a'
2442 (?{local $c = $c + 1;}) # increment count
2443 )* # do this any number of times,
2444 aa # but match 'aa' at the end
2445 (?{$count = $c;}) # copy local $c var into $count
2446 /x;
2447 print "'a' count is $count, \$c variable is '$c'\n";
2448
2449 This prints
2450
2451 'a' count is 2, $c variable is 'bob'
2452
2453 If we replace the " (?{local $c = $c + 1;})" with " (?{$c = $c + 1;})",
2454 the variable changes are not undone during backtracking, and we get
2455
2456 'a' count is 4, $c variable is 'bob'
2457
2458 Note that only localized variable changes are undone. Other side
2459 effects of code expression execution are permanent. Thus
2460
2461 $x = "aaaa";
2462 $x =~ /(a(?{print "Yow\n";}))*aa/;
2463
2464 produces
2465
2466 Yow
2467 Yow
2468 Yow
2469 Yow
2470
2471 The result $^R is automatically localized, so that it will behave
2472 properly in the presence of backtracking.
2473
2474 This example uses a code expression in a conditional to match a
2475 definite article, either 'the' in English or 'der|die|das' in German:
2476
2477 $lang = 'DE'; # use German
2478 ...
2479 $text = "das";
2480 print "matched\n"
2481 if $text =~ /(?(?{
2482 $lang eq 'EN'; # is the language English?
2483 })
2484 the | # if so, then match 'the'
2485 (der|die|das) # else, match 'der|die|das'
2486 )
2487 /xi;
2488
2489 Note that the syntax here is "(?(?{...})yes-regexp|no-regexp)", not
2490 "(?((?{...}))yes-regexp|no-regexp)". In other words, in the case of a
2491 code expression, we don't need the extra parentheses around the
2492 conditional.
2493
2494 If you try to use code expressions where the code text is contained
2495 within an interpolated variable, rather than appearing literally in the
2496 pattern, Perl may surprise you:
2497
2498 $bar = 5;
2499 $pat = '(?{ 1 })';
2500 /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
2501 /foo(?{ 1 })$bar/; # compiles ok, $bar interpolated
2502 /foo${pat}bar/; # compile error!
2503
2504 $pat = qr/(?{ $foo = 1 })/; # precompile code regexp
2505 /foo${pat}bar/; # compiles ok
2506
2507 If a regexp has a variable that interpolates a code expression, Perl
2508 treats the regexp as an error. If the code expression is precompiled
2509 into a variable, however, interpolating is ok. The question is, why is
2510 this an error?
2511
2512 The reason is that variable interpolation and code expressions together
2513 pose a security risk. The combination is dangerous because many
2514 programmers who write search engines often take user input and plug it
2515 directly into a regexp:
2516
2517 $regexp = <>; # read user-supplied regexp
2518 $chomp $regexp; # get rid of possible newline
2519 $text =~ /$regexp/; # search $text for the $regexp
2520
2521 If the $regexp variable contains a code expression, the user could then
2522 execute arbitrary Perl code. For instance, some joker could search for
2523 "system('rm -rf *');" to erase your files. In this sense, the
2524 combination of interpolation and code expressions taints your regexp.
2525 So by default, using both interpolation and code expressions in the
2526 same regexp is not allowed. If you're not concerned about malicious
2527 users, it is possible to bypass this security check by invoking
2528 "use re 'eval'":
2529
2530 use re 'eval'; # throw caution out the door
2531 $bar = 5;
2532 $pat = '(?{ 1 })';
2533 /foo${pat}bar/; # compiles ok
2534
2535 Another form of code expression is the pattern code expression. The
2536 pattern code expression is like a regular code expression, except that
2537 the result of the code evaluation is treated as a regular expression
2538 and matched immediately. A simple example is
2539
2540 $length = 5;
2541 $char = 'a';
2542 $x = 'aaaaabb';
2543 $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
2544
2545 This final example contains both ordinary and pattern code expressions.
2546 It detects whether a binary string 1101010010001... has a Fibonacci
2547 spacing 0,1,1,2,3,5,... of the '1''s:
2548
2549 $x = "1101010010001000001";
2550 $z0 = ''; $z1 = '0'; # initial conditions
2551 print "It is a Fibonacci sequence\n"
2552 if $x =~ /^1 # match an initial '1'
2553 (?:
2554 ((??{ $z0 })) # match some '0'
2555 1 # and then a '1'
2556 (?{ $z0 = $z1; $z1 .= $^N; })
2557 )+ # repeat as needed
2558 $ # that is all there is
2559 /x;
2560 printf "Largest sequence matched was %d\n", length($z1)-length($z0);
2561
2562 Remember that $^N is set to whatever was matched by the last completed
2563 capture group. This prints
2564
2565 It is a Fibonacci sequence
2566 Largest sequence matched was 5
2567
2568 Ha! Try that with your garden variety regexp package...
2569
2570 Note that the variables $z0 and $z1 are not substituted when the regexp
2571 is compiled, as happens for ordinary variables outside a code
2572 expression. Rather, the whole code block is parsed as perl code at the
2573 same time as perl is compiling the code containing the literal regexp
2574 pattern.
2575
2576 This regexp without the "/x" modifier is
2577
2578 /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/
2579
2580 which shows that spaces are still possible in the code parts.
2581 Nevertheless, when working with code and conditional expressions, the
2582 extended form of regexps is almost necessary in creating and debugging
2583 regexps.
2584
2585 Backtracking control verbs
2586 Perl 5.10 introduced a number of control verbs intended to provide
2587 detailed control over the backtracking process, by directly influencing
2588 the regexp engine and by providing monitoring techniques. See "Special
2589 Backtracking Control Verbs" in perlre for a detailed description.
2590
2591 Below is just one example, illustrating the control verb "(*FAIL)",
2592 which may be abbreviated as "(*F)". If this is inserted in a regexp it
2593 will cause it to fail, just as it would at some mismatch between the
2594 pattern and the string. Processing of the regexp continues as it would
2595 after any "normal" failure, so that, for instance, the next position in
2596 the string or another alternative will be tried. As failing to match
2597 doesn't preserve capture groups or produce results, it may be necessary
2598 to use this in combination with embedded code.
2599
2600 %count = ();
2601 "supercalifragilisticexpialidocious" =~
2602 /([aeiou])(?{ $count{$1}++; })(*FAIL)/i;
2603 printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);
2604
2605 The pattern begins with a class matching a subset of letters. Whenever
2606 this matches, a statement like "$count{'a'}++;" is executed,
2607 incrementing the letter's counter. Then "(*FAIL)" does what it says,
2608 and the regexp engine proceeds according to the book: as long as the
2609 end of the string hasn't been reached, the position is advanced before
2610 looking for another vowel. Thus, match or no match makes no difference,
2611 and the regexp engine proceeds until the entire string has been
2612 inspected. (It's remarkable that an alternative solution using
2613 something like
2614
2615 $count{lc($_)}++ for split('', "supercalifragilisticexpialidocious");
2616 printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );
2617
2618 is considerably slower.)
2619
2620 Pragmas and debugging
2621 Speaking of debugging, there are several pragmas available to control
2622 and debug regexps in Perl. We have already encountered one pragma in
2623 the previous section, "use re 'eval';", that allows variable
2624 interpolation and code expressions to coexist in a regexp. The other
2625 pragmas are
2626
2627 use re 'taint';
2628 $tainted = <>;
2629 @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
2630
2631 The "taint" pragma causes any substrings from a match with a tainted
2632 variable to be tainted as well. This is not normally the case, as
2633 regexps are often used to extract the safe bits from a tainted
2634 variable. Use "taint" when you are not extracting safe bits, but are
2635 performing some other processing. Both "taint" and "eval" pragmas are
2636 lexically scoped, which means they are in effect only until the end of
2637 the block enclosing the pragmas.
2638
2639 use re '/m'; # or any other flags
2640 $multiline_string =~ /^foo/; # /m is implied
2641
2642 The "re '/flags'" pragma (introduced in Perl 5.14) turns on the given
2643 regular expression flags until the end of the lexical scope. See
2644 "'/flags' mode" in re for more detail.
2645
2646 use re 'debug';
2647 /^(.*)$/s; # output debugging info
2648
2649 use re 'debugcolor';
2650 /^(.*)$/s; # output debugging info in living color
2651
2652 The global "debug" and "debugcolor" pragmas allow one to get detailed
2653 debugging info about regexp compilation and execution. "debugcolor" is
2654 the same as debug, except the debugging information is displayed in
2655 color on terminals that can display termcap color sequences. Here is
2656 example output:
2657
2658 % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
2659 Compiling REx 'a*b+c'
2660 size 9 first at 1
2661 1: STAR(4)
2662 2: EXACT <a>(0)
2663 4: PLUS(7)
2664 5: EXACT <b>(0)
2665 7: EXACT <c>(9)
2666 9: END(0)
2667 floating 'bc' at 0..2147483647 (checking floating) minlen 2
2668 Guessing start of match, REx 'a*b+c' against 'abc'...
2669 Found floating substr 'bc' at offset 1...
2670 Guessed: match at offset 0
2671 Matching REx 'a*b+c' against 'abc'
2672 Setting an EVAL scope, savestack=3
2673 0 <> <abc> | 1: STAR
2674 EXACT <a> can match 1 times out of 32767...
2675 Setting an EVAL scope, savestack=3
2676 1 <a> <bc> | 4: PLUS
2677 EXACT <b> can match 1 times out of 32767...
2678 Setting an EVAL scope, savestack=3
2679 2 <ab> <c> | 7: EXACT <c>
2680 3 <abc> <> | 9: END
2681 Match successful!
2682 Freeing REx: 'a*b+c'
2683
2684 If you have gotten this far into the tutorial, you can probably guess
2685 what the different parts of the debugging output tell you. The first
2686 part
2687
2688 Compiling REx 'a*b+c'
2689 size 9 first at 1
2690 1: STAR(4)
2691 2: EXACT <a>(0)
2692 4: PLUS(7)
2693 5: EXACT <b>(0)
2694 7: EXACT <c>(9)
2695 9: END(0)
2696
2697 describes the compilation stage. STAR(4) means that there is a starred
2698 object, in this case 'a', and if it matches, goto line 4, i.e.,
2699 PLUS(7). The middle lines describe some heuristics and optimizations
2700 performed before a match:
2701
2702 floating 'bc' at 0..2147483647 (checking floating) minlen 2
2703 Guessing start of match, REx 'a*b+c' against 'abc'...
2704 Found floating substr 'bc' at offset 1...
2705 Guessed: match at offset 0
2706
2707 Then the match is executed and the remaining lines describe the
2708 process:
2709
2710 Matching REx 'a*b+c' against 'abc'
2711 Setting an EVAL scope, savestack=3
2712 0 <> <abc> | 1: STAR
2713 EXACT <a> can match 1 times out of 32767...
2714 Setting an EVAL scope, savestack=3
2715 1 <a> <bc> | 4: PLUS
2716 EXACT <b> can match 1 times out of 32767...
2717 Setting an EVAL scope, savestack=3
2718 2 <ab> <c> | 7: EXACT <c>
2719 3 <abc> <> | 9: END
2720 Match successful!
2721 Freeing REx: 'a*b+c'
2722
2723 Each step is of the form "n <x> <y>", with "<x>" the part of the string
2724 matched and "<y>" the part not yet matched. The "| 1: STAR" says
2725 that Perl is at line number 1 in the compilation list above. See
2726 "Debugging Regular Expressions" in perldebguts for much more detail.
2727
2728 An alternative method of debugging regexps is to embed "print"
2729 statements within the regexp. This provides a blow-by-blow account of
2730 the backtracking in an alternation:
2731
2732 "that this" =~ m@(?{print "Start at position ", pos, "\n";})
2733 t(?{print "t1\n";})
2734 h(?{print "h1\n";})
2735 i(?{print "i1\n";})
2736 s(?{print "s1\n";})
2737 |
2738 t(?{print "t2\n";})
2739 h(?{print "h2\n";})
2740 a(?{print "a2\n";})
2741 t(?{print "t2\n";})
2742 (?{print "Done at position ", pos, "\n";})
2743 @x;
2744
2745 prints
2746
2747 Start at position 0
2748 t1
2749 h1
2750 t2
2751 h2
2752 a2
2753 t2
2754 Done at position 4
2755
2757 This is just a tutorial. For the full story on Perl regular
2758 expressions, see the perlre regular expressions reference page.
2759
2760 For more information on the matching "m//" and substitution "s///"
2761 operators, see "Regexp Quote-Like Operators" in perlop. For
2762 information on the "split" operation, see "split" in perlfunc.
2763
2764 For an excellent all-around resource on the care and feeding of regular
2765 expressions, see the book Mastering Regular Expressions by Jeffrey
2766 Friedl (published by O'Reilly, ISBN 1556592-257-3).
2767
2769 Copyright (c) 2000 Mark Kvale. All rights reserved. Now maintained by
2770 Perl porters.
2771
2772 This document may be distributed under the same terms as Perl itself.
2773
2774 Acknowledgments
2775 The inspiration for the stop codon DNA example came from the ZIP code
2776 example in chapter 7 of Mastering Regular Expressions.
2777
2778 The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
2779 Haworth, Ronald J Kimball, and Joe Smith for all their helpful
2780 comments.
2781
2782
2783
2784perl v5.28.2 2018-11-01 PERLRETUT(1)